ID: 1134767912

View in Genome Browser
Species Human (GRCh38)
Location 16:16777869-16777891
Sequence CTGGATCTACAGATATACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134767912_1134767913 -9 Left 1134767912 16:16777869-16777891 CCTTGGTATATCTGTAGATCCAG No data
Right 1134767913 16:16777883-16777905 TAGATCCAGCCTTTTAGCACAGG No data
1134767912_1134767916 0 Left 1134767912 16:16777869-16777891 CCTTGGTATATCTGTAGATCCAG No data
Right 1134767916 16:16777892-16777914 CCTTTTAGCACAGGTATAACAGG No data
1134767912_1134767917 20 Left 1134767912 16:16777869-16777891 CCTTGGTATATCTGTAGATCCAG No data
Right 1134767917 16:16777912-16777934 AGGCAATGATGCCATTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134767912 Original CRISPR CTGGATCTACAGATATACCA AGG (reversed) Intergenic
No off target data available for this crispr