ID: 1134768195

View in Genome Browser
Species Human (GRCh38)
Location 16:16780931-16780953
Sequence CAGGCACACTGGCCCTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134768195_1134768200 21 Left 1134768195 16:16780931-16780953 CCTCAGGAGGGCCAGTGTGCCTG No data
Right 1134768200 16:16780975-16780997 GTTCTATAGTGGGTTACCACAGG No data
1134768195_1134768198 10 Left 1134768195 16:16780931-16780953 CCTCAGGAGGGCCAGTGTGCCTG No data
Right 1134768198 16:16780964-16780986 TCTACTGATCAGTTCTATAGTGG No data
1134768195_1134768199 11 Left 1134768195 16:16780931-16780953 CCTCAGGAGGGCCAGTGTGCCTG No data
Right 1134768199 16:16780965-16780987 CTACTGATCAGTTCTATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134768195 Original CRISPR CAGGCACACTGGCCCTCCTG AGG (reversed) Intergenic
No off target data available for this crispr