ID: 1134769229

View in Genome Browser
Species Human (GRCh38)
Location 16:16791723-16791745
Sequence CTTCAAATTCAGATGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134769229_1134769233 6 Left 1134769229 16:16791723-16791745 CCCAGGTCCATCTGAATTTGAAG No data
Right 1134769233 16:16791752-16791774 ATCTTATTCACTATGTGGACAGG No data
1134769229_1134769232 1 Left 1134769229 16:16791723-16791745 CCCAGGTCCATCTGAATTTGAAG No data
Right 1134769232 16:16791747-16791769 TTAACATCTTATTCACTATGTGG No data
1134769229_1134769234 28 Left 1134769229 16:16791723-16791745 CCCAGGTCCATCTGAATTTGAAG No data
Right 1134769234 16:16791774-16791796 GCTATAGATACATAATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134769229 Original CRISPR CTTCAAATTCAGATGGACCT GGG (reversed) Intergenic
No off target data available for this crispr