ID: 1134770485

View in Genome Browser
Species Human (GRCh38)
Location 16:16804943-16804965
Sequence AGTCTCTCACTTCCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134770480_1134770485 13 Left 1134770480 16:16804907-16804929 CCAGGGAGTTCTTGAACCAAACT No data
Right 1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG No data
1134770483_1134770485 -3 Left 1134770483 16:16804923-16804945 CCAAACTTGGCTGTTAGAGGAGT No data
Right 1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG No data
1134770479_1134770485 16 Left 1134770479 16:16804904-16804926 CCACCAGGGAGTTCTTGAACCAA No data
Right 1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134770485 Original CRISPR AGTCTCTCACTTCCCAGGAA AGG Intergenic
No off target data available for this crispr