ID: 1134772060

View in Genome Browser
Species Human (GRCh38)
Location 16:16817709-16817731
Sequence TGGGCATCAGTGAACAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134772060_1134772062 -6 Left 1134772060 16:16817709-16817731 CCTTGTTTGTTCACTGATGCCCA No data
Right 1134772062 16:16817726-16817748 TGCCCAGTAAATCAGAACCAGGG No data
1134772060_1134772061 -7 Left 1134772060 16:16817709-16817731 CCTTGTTTGTTCACTGATGCCCA No data
Right 1134772061 16:16817725-16817747 ATGCCCAGTAAATCAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134772060 Original CRISPR TGGGCATCAGTGAACAAACA AGG (reversed) Intergenic
No off target data available for this crispr