ID: 1134775551

View in Genome Browser
Species Human (GRCh38)
Location 16:16850188-16850210
Sequence CCTTCCTCTATGAGTTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134775551_1134775556 1 Left 1134775551 16:16850188-16850210 CCAATCTAACTCATAGAGGAAGG No data
Right 1134775556 16:16850212-16850234 TTCCTGGAGGAGATAAACCTCGG No data
1134775551_1134775559 23 Left 1134775551 16:16850188-16850210 CCAATCTAACTCATAGAGGAAGG No data
Right 1134775559 16:16850234-16850256 GTAAAAACATTAGTATGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134775551 Original CRISPR CCTTCCTCTATGAGTTAGAT TGG (reversed) Intergenic
No off target data available for this crispr