ID: 1134775557

View in Genome Browser
Species Human (GRCh38)
Location 16:16850214-16850236
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134775557_1134775561 12 Left 1134775557 16:16850214-16850236 CCTGGAGGAGATAAACCTCGGTA No data
Right 1134775561 16:16850249-16850271 TGAATTGGTATTAGATAAGGTGG No data
1134775557_1134775560 9 Left 1134775557 16:16850214-16850236 CCTGGAGGAGATAAACCTCGGTA No data
Right 1134775560 16:16850246-16850268 GTATGAATTGGTATTAGATAAGG No data
1134775557_1134775559 -3 Left 1134775557 16:16850214-16850236 CCTGGAGGAGATAAACCTCGGTA No data
Right 1134775559 16:16850234-16850256 GTAAAAACATTAGTATGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134775557 Original CRISPR TACCGAGGTTTATCTCCTCC AGG (reversed) Intergenic
No off target data available for this crispr