ID: 1134775560

View in Genome Browser
Species Human (GRCh38)
Location 16:16850246-16850268
Sequence GTATGAATTGGTATTAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134775558_1134775560 -6 Left 1134775558 16:16850229-16850251 CCTCGGTAAAAACATTAGTATGA No data
Right 1134775560 16:16850246-16850268 GTATGAATTGGTATTAGATAAGG No data
1134775557_1134775560 9 Left 1134775557 16:16850214-16850236 CCTGGAGGAGATAAACCTCGGTA No data
Right 1134775560 16:16850246-16850268 GTATGAATTGGTATTAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134775560 Original CRISPR GTATGAATTGGTATTAGATA AGG Intergenic
No off target data available for this crispr