ID: 1134776862

View in Genome Browser
Species Human (GRCh38)
Location 16:16860772-16860794
Sequence GATAACGCACAGAGTGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134776859_1134776862 5 Left 1134776859 16:16860744-16860766 CCATGGGGTTGTTGTGAAGATGA No data
Right 1134776862 16:16860772-16860794 GATAACGCACAGAGTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134776862 Original CRISPR GATAACGCACAGAGTGCTCT TGG Intergenic
No off target data available for this crispr