ID: 1134778459

View in Genome Browser
Species Human (GRCh38)
Location 16:16873390-16873412
Sequence CCTCTCCTGCAGAGGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134778459_1134778474 18 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778474 16:16873431-16873453 TTGGGTTAAAAGTAGGGGAAGGG No data
1134778459_1134778473 17 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778473 16:16873430-16873452 CTTGGGTTAAAAGTAGGGGAAGG No data
1134778459_1134778470 11 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778470 16:16873424-16873446 GAATCACTTGGGTTAAAAGTAGG No data
1134778459_1134778466 0 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778466 16:16873413-16873435 AAGCCCCACTCGAATCACTTGGG No data
1134778459_1134778465 -1 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778465 16:16873412-16873434 GAAGCCCCACTCGAATCACTTGG No data
1134778459_1134778475 29 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778475 16:16873442-16873464 GTAGGGGAAGGGTTAATCTCAGG No data
1134778459_1134778471 12 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778471 16:16873425-16873447 AATCACTTGGGTTAAAAGTAGGG No data
1134778459_1134778472 13 Left 1134778459 16:16873390-16873412 CCGCCCCACCTCTGCAGGAGAGG No data
Right 1134778472 16:16873426-16873448 ATCACTTGGGTTAAAAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134778459 Original CRISPR CCTCTCCTGCAGAGGTGGGG CGG (reversed) Intergenic
No off target data available for this crispr