ID: 1134781137

View in Genome Browser
Species Human (GRCh38)
Location 16:16896433-16896455
Sequence TACCCAAGGATGCTGAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134781126_1134781137 17 Left 1134781126 16:16896393-16896415 CCAGGGAGTTCTGTGAAATCTGG No data
Right 1134781137 16:16896433-16896455 TACCCAAGGATGCTGAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134781137 Original CRISPR TACCCAAGGATGCTGAGCAA GGG Intergenic
No off target data available for this crispr