ID: 1134784586

View in Genome Browser
Species Human (GRCh38)
Location 16:16930225-16930247
Sequence GTGAGTTACCTTACATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134784586_1134784590 -1 Left 1134784586 16:16930225-16930247 CCCAGAGATGTAAGGTAACTCAC No data
Right 1134784590 16:16930247-16930269 CTCAAGGTCAGGACAGTAAGTGG No data
1134784586_1134784591 8 Left 1134784586 16:16930225-16930247 CCCAGAGATGTAAGGTAACTCAC No data
Right 1134784591 16:16930256-16930278 AGGACAGTAAGTGGCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134784586 Original CRISPR GTGAGTTACCTTACATCTCT GGG (reversed) Intergenic
No off target data available for this crispr