ID: 1134785609

View in Genome Browser
Species Human (GRCh38)
Location 16:16939941-16939963
Sequence ATCAAAAAATCTGGCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134785609_1134785613 29 Left 1134785609 16:16939941-16939963 CCTGAGGAGCCAGATTTTTTGAT No data
Right 1134785613 16:16939993-16940015 TTCCCATGCCCACTTTGGAATGG No data
1134785609_1134785614 30 Left 1134785609 16:16939941-16939963 CCTGAGGAGCCAGATTTTTTGAT No data
Right 1134785614 16:16939994-16940016 TCCCATGCCCACTTTGGAATGGG No data
1134785609_1134785612 24 Left 1134785609 16:16939941-16939963 CCTGAGGAGCCAGATTTTTTGAT No data
Right 1134785612 16:16939988-16940010 GCATTTTCCCATGCCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134785609 Original CRISPR ATCAAAAAATCTGGCTCCTC AGG (reversed) Intergenic
No off target data available for this crispr