ID: 1134785610

View in Genome Browser
Species Human (GRCh38)
Location 16:16939950-16939972
Sequence TGCTGTCTTATCAAAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134785610_1134785613 20 Left 1134785610 16:16939950-16939972 CCAGATTTTTTGATAAGACAGCA No data
Right 1134785613 16:16939993-16940015 TTCCCATGCCCACTTTGGAATGG No data
1134785610_1134785614 21 Left 1134785610 16:16939950-16939972 CCAGATTTTTTGATAAGACAGCA No data
Right 1134785614 16:16939994-16940016 TCCCATGCCCACTTTGGAATGGG No data
1134785610_1134785612 15 Left 1134785610 16:16939950-16939972 CCAGATTTTTTGATAAGACAGCA No data
Right 1134785612 16:16939988-16940010 GCATTTTCCCATGCCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134785610 Original CRISPR TGCTGTCTTATCAAAAAATC TGG (reversed) Intergenic