ID: 1134785612

View in Genome Browser
Species Human (GRCh38)
Location 16:16939988-16940010
Sequence GCATTTTCCCATGCCCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134785609_1134785612 24 Left 1134785609 16:16939941-16939963 CCTGAGGAGCCAGATTTTTTGAT No data
Right 1134785612 16:16939988-16940010 GCATTTTCCCATGCCCACTTTGG No data
1134785610_1134785612 15 Left 1134785610 16:16939950-16939972 CCAGATTTTTTGATAAGACAGCA No data
Right 1134785612 16:16939988-16940010 GCATTTTCCCATGCCCACTTTGG No data
1134785611_1134785612 -10 Left 1134785611 16:16939975-16939997 CCTCTGACATACAGCATTTTCCC No data
Right 1134785612 16:16939988-16940010 GCATTTTCCCATGCCCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134785612 Original CRISPR GCATTTTCCCATGCCCACTT TGG Intergenic
No off target data available for this crispr