ID: 1134787833

View in Genome Browser
Species Human (GRCh38)
Location 16:16961121-16961143
Sequence CTGTTGTTGAATAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134787833_1134787839 -1 Left 1134787833 16:16961121-16961143 CCCTCCTGCCTATTCAACAACAG No data
Right 1134787839 16:16961143-16961165 GCATTGGCTCCAACCCTGGTTGG No data
1134787833_1134787840 2 Left 1134787833 16:16961121-16961143 CCCTCCTGCCTATTCAACAACAG No data
Right 1134787840 16:16961146-16961168 TTGGCTCCAACCCTGGTTGGTGG No data
1134787833_1134787838 -5 Left 1134787833 16:16961121-16961143 CCCTCCTGCCTATTCAACAACAG No data
Right 1134787838 16:16961139-16961161 AACAGCATTGGCTCCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134787833 Original CRISPR CTGTTGTTGAATAGGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr