ID: 1134787873

View in Genome Browser
Species Human (GRCh38)
Location 16:16961486-16961508
Sequence TTGTGGTTAAGCAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134787873_1134787883 9 Left 1134787873 16:16961486-16961508 CCCTCTTCCCTGCTTAACCACAA No data
Right 1134787883 16:16961518-16961540 CCCACTTAGCATCATGGCGGGGG No data
1134787873_1134787885 10 Left 1134787873 16:16961486-16961508 CCCTCTTCCCTGCTTAACCACAA No data
Right 1134787885 16:16961519-16961541 CCACTTAGCATCATGGCGGGGGG No data
1134787873_1134787881 8 Left 1134787873 16:16961486-16961508 CCCTCTTCCCTGCTTAACCACAA No data
Right 1134787881 16:16961517-16961539 ACCCACTTAGCATCATGGCGGGG No data
1134787873_1134787880 7 Left 1134787873 16:16961486-16961508 CCCTCTTCCCTGCTTAACCACAA No data
Right 1134787880 16:16961516-16961538 AACCCACTTAGCATCATGGCGGG No data
1134787873_1134787879 6 Left 1134787873 16:16961486-16961508 CCCTCTTCCCTGCTTAACCACAA No data
Right 1134787879 16:16961515-16961537 AAACCCACTTAGCATCATGGCGG No data
1134787873_1134787878 3 Left 1134787873 16:16961486-16961508 CCCTCTTCCCTGCTTAACCACAA No data
Right 1134787878 16:16961512-16961534 GAGAAACCCACTTAGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134787873 Original CRISPR TTGTGGTTAAGCAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr