ID: 1134788955

View in Genome Browser
Species Human (GRCh38)
Location 16:16971160-16971182
Sequence ATCTAGAAACTGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134788955_1134788958 26 Left 1134788955 16:16971160-16971182 CCATCTTCCTTCAGTTTCTAGAT No data
Right 1134788958 16:16971209-16971231 GACCTCACTCCATGACAACAGGG No data
1134788955_1134788957 25 Left 1134788955 16:16971160-16971182 CCATCTTCCTTCAGTTTCTAGAT No data
Right 1134788957 16:16971208-16971230 TGACCTCACTCCATGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134788955 Original CRISPR ATCTAGAAACTGAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr