ID: 1134790202

View in Genome Browser
Species Human (GRCh38)
Location 16:16982826-16982848
Sequence CAGTTGGTTACACCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134790202_1134790207 1 Left 1134790202 16:16982826-16982848 CCTTCAAAGGGTGTAACCAACTG No data
Right 1134790207 16:16982850-16982872 AGACCTCTAAAAGGCACCTAGGG No data
1134790202_1134790206 0 Left 1134790202 16:16982826-16982848 CCTTCAAAGGGTGTAACCAACTG No data
Right 1134790206 16:16982849-16982871 GAGACCTCTAAAAGGCACCTAGG No data
1134790202_1134790208 2 Left 1134790202 16:16982826-16982848 CCTTCAAAGGGTGTAACCAACTG No data
Right 1134790208 16:16982851-16982873 GACCTCTAAAAGGCACCTAGGGG No data
1134790202_1134790211 21 Left 1134790202 16:16982826-16982848 CCTTCAAAGGGTGTAACCAACTG No data
Right 1134790211 16:16982870-16982892 GGGGTGTTGCCAAGTTCTTTTGG 0: 6
1: 4
2: 5
3: 12
4: 339
1134790202_1134790204 -8 Left 1134790202 16:16982826-16982848 CCTTCAAAGGGTGTAACCAACTG No data
Right 1134790204 16:16982841-16982863 ACCAACTGGAGACCTCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134790202 Original CRISPR CAGTTGGTTACACCCTTTGA AGG (reversed) Intergenic
No off target data available for this crispr