ID: 1134794443

View in Genome Browser
Species Human (GRCh38)
Location 16:17022153-17022175
Sequence TTCTGTATGATATACATGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134794443_1134794450 26 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794450 16:17022202-17022224 TGCAAGGGGGGATGTTTCAGAGG No data
1134794443_1134794452 28 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794452 16:17022204-17022226 CAAGGGGGGATGTTTCAGAGGGG No data
1134794443_1134794451 27 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794451 16:17022203-17022225 GCAAGGGGGGATGTTTCAGAGGG No data
1134794443_1134794449 14 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794449 16:17022190-17022212 TATATCAATGTGTGCAAGGGGGG No data
1134794443_1134794446 11 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794446 16:17022187-17022209 TTATATATCAATGTGTGCAAGGG No data
1134794443_1134794448 13 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794448 16:17022189-17022211 ATATATCAATGTGTGCAAGGGGG No data
1134794443_1134794447 12 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794447 16:17022188-17022210 TATATATCAATGTGTGCAAGGGG No data
1134794443_1134794445 10 Left 1134794443 16:17022153-17022175 CCGTACATGTATATCATACAGAA No data
Right 1134794445 16:17022186-17022208 ATTATATATCAATGTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134794443 Original CRISPR TTCTGTATGATATACATGTA CGG (reversed) Intergenic
No off target data available for this crispr