ID: 1134795005

View in Genome Browser
Species Human (GRCh38)
Location 16:17027076-17027098
Sequence ATGCTATTATTCATGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134795005_1134795007 -9 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795007 16:17027090-17027112 TAATAGCATTGAGTGCTAGTGGG No data
1134795005_1134795010 -3 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795010 16:17027096-17027118 CATTGAGTGCTAGTGGGGGAAGG No data
1134795005_1134795009 -7 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795009 16:17027092-17027114 ATAGCATTGAGTGCTAGTGGGGG No data
1134795005_1134795011 -2 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795011 16:17027097-17027119 ATTGAGTGCTAGTGGGGGAAGGG No data
1134795005_1134795013 0 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795013 16:17027099-17027121 TGAGTGCTAGTGGGGGAAGGGGG No data
1134795005_1134795014 5 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795014 16:17027104-17027126 GCTAGTGGGGGAAGGGGGTATGG No data
1134795005_1134795016 17 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795016 16:17027116-17027138 AGGGGGTATGGTGGTAAATTCGG No data
1134795005_1134795008 -8 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795008 16:17027091-17027113 AATAGCATTGAGTGCTAGTGGGG No data
1134795005_1134795012 -1 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795012 16:17027098-17027120 TTGAGTGCTAGTGGGGGAAGGGG No data
1134795005_1134795015 8 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795015 16:17027107-17027129 AGTGGGGGAAGGGGGTATGGTGG No data
1134795005_1134795006 -10 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795006 16:17027089-17027111 ATAATAGCATTGAGTGCTAGTGG No data
1134795005_1134795017 18 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795017 16:17027117-17027139 GGGGGTATGGTGGTAAATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134795005 Original CRISPR ATGCTATTATTCATGCAACC TGG (reversed) Intergenic
No off target data available for this crispr