ID: 1134795008

View in Genome Browser
Species Human (GRCh38)
Location 16:17027091-17027113
Sequence AATAGCATTGAGTGCTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134795005_1134795008 -8 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795008 16:17027091-17027113 AATAGCATTGAGTGCTAGTGGGG No data
1134795002_1134795008 21 Left 1134795002 16:17027047-17027069 CCTAGTCTAAAGGAGATGTCACT No data
Right 1134795008 16:17027091-17027113 AATAGCATTGAGTGCTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134795008 Original CRISPR AATAGCATTGAGTGCTAGTG GGG Intergenic
No off target data available for this crispr