ID: 1134795008 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:17027091-17027113 |
| Sequence | AATAGCATTGAGTGCTAGTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1134795005_1134795008 | -8 | Left | 1134795005 | 16:17027076-17027098 | CCAGGTTGCATGAATAATAGCAT | No data | ||
| Right | 1134795008 | 16:17027091-17027113 | AATAGCATTGAGTGCTAGTGGGG | No data | ||||
| 1134795002_1134795008 | 21 | Left | 1134795002 | 16:17027047-17027069 | CCTAGTCTAAAGGAGATGTCACT | No data | ||
| Right | 1134795008 | 16:17027091-17027113 | AATAGCATTGAGTGCTAGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1134795008 | Original CRISPR | AATAGCATTGAGTGCTAGTG GGG | Intergenic | ||
| No off target data available for this crispr | |||||