ID: 1134795014

View in Genome Browser
Species Human (GRCh38)
Location 16:17027104-17027126
Sequence GCTAGTGGGGGAAGGGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134795005_1134795014 5 Left 1134795005 16:17027076-17027098 CCAGGTTGCATGAATAATAGCAT No data
Right 1134795014 16:17027104-17027126 GCTAGTGGGGGAAGGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134795014 Original CRISPR GCTAGTGGGGGAAGGGGGTA TGG Intergenic
No off target data available for this crispr