ID: 1134805266

View in Genome Browser
Species Human (GRCh38)
Location 16:17118820-17118842
Sequence GTGGCTAAAACAAGGCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134805266_1134805269 -8 Left 1134805266 16:17118820-17118842 CCAGGATGCCTTGTTTTAGCCAC No data
Right 1134805269 16:17118835-17118857 TTAGCCACCTCAATCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134805266 Original CRISPR GTGGCTAAAACAAGGCATCC TGG (reversed) Intronic
No off target data available for this crispr