ID: 1134807471

View in Genome Browser
Species Human (GRCh38)
Location 16:17138242-17138264
Sequence TATCACATGGTGCCCAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134807471_1134807477 15 Left 1134807471 16:17138242-17138264 CCAGGTTTGGGCACCATGTGATA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1134807477 16:17138280-17138302 CTGGCCTTGGATTTCTGCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 221
1134807471_1134807475 2 Left 1134807471 16:17138242-17138264 CCAGGTTTGGGCACCATGTGATA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1134807475 16:17138267-17138289 ATGACCTGCAGGTCTGGCCTTGG 0: 1
1: 0
2: 0
3: 18
4: 195
1134807471_1134807480 24 Left 1134807471 16:17138242-17138264 CCAGGTTTGGGCACCATGTGATA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1134807480 16:17138289-17138311 GATTTCTGCAGAGGTTTGTTGGG 0: 1
1: 0
2: 1
3: 47
4: 1037
1134807471_1134807481 28 Left 1134807471 16:17138242-17138264 CCAGGTTTGGGCACCATGTGATA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1134807481 16:17138293-17138315 TCTGCAGAGGTTTGTTGGGAAGG 0: 1
1: 0
2: 2
3: 19
4: 228
1134807471_1134807474 -4 Left 1134807471 16:17138242-17138264 CCAGGTTTGGGCACCATGTGATA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1134807474 16:17138261-17138283 GATAAGATGACCTGCAGGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 106
1134807471_1134807473 -9 Left 1134807471 16:17138242-17138264 CCAGGTTTGGGCACCATGTGATA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1134807473 16:17138256-17138278 CATGTGATAAGATGACCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 103
1134807471_1134807479 23 Left 1134807471 16:17138242-17138264 CCAGGTTTGGGCACCATGTGATA 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1134807479 16:17138288-17138310 GGATTTCTGCAGAGGTTTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134807471 Original CRISPR TATCACATGGTGCCCAAACC TGG (reversed) Intronic
911960788 1:104300318-104300340 TATCACATGCTCCTGAAACCTGG + Intergenic
919454726 1:197807770-197807792 TATCAAATGGTCCCCAAAGAGGG - Intergenic
921566612 1:216729194-216729216 GATCATATGGTCCCCAAACTGGG - Intronic
922050009 1:221979720-221979742 TATCCTATGGAGCCCAAACTTGG + Intergenic
922328178 1:224548693-224548715 TATCACAGGGTGTCCACACAGGG - Intronic
922598724 1:226833940-226833962 TAACATTTGGTGCCGAAACCTGG + Intergenic
924722934 1:246639695-246639717 TTGCACCTGGTGCCGAAACCCGG - Intronic
924945511 1:248843924-248843946 TATTCCCTGCTGCCCAAACCAGG + Intronic
1064140490 10:12785961-12785983 TTTGATATGGTGGCCAAACCGGG - Intronic
1064869755 10:19924264-19924286 TAACATTTGGTGCCAAAACCTGG + Intronic
1070338266 10:75474014-75474036 TCTCACGTGGTCCACAAACCAGG - Intronic
1070426683 10:76295480-76295502 TATCACATGGTCACTAAACCTGG + Intronic
1070735611 10:78861810-78861832 TACCCCATGGTGGCCAATCCTGG + Intergenic
1078004200 11:7520049-7520071 TTTCATCTGGTGCCGAAACCTGG - Intronic
1079125635 11:17716903-17716925 TTTCAAATTTTGCCCAAACCTGG + Intergenic
1079698511 11:23514513-23514535 TATCACATTGTCCAAAAACCAGG - Intergenic
1084092155 11:66885839-66885861 CATCACAGGGTGCCAAAAGCTGG - Intronic
1088721400 11:112595233-112595255 TATCAAATGGTCCCCGAACAAGG - Intergenic
1089174373 11:116537718-116537740 TATGACATGGTGCACACCCCGGG + Intergenic
1089674280 11:120079600-120079622 TCTCCCATGATCCCCAAACCAGG - Intergenic
1095908636 12:47403485-47403507 TATCACAAGGTGCCCCACTCTGG - Intergenic
1096674008 12:53216911-53216933 TAGGACCTGTTGCCCAAACCTGG + Intronic
1097921030 12:65073958-65073980 TATCACCTGGTTCCCAAAGAAGG + Intronic
1100196798 12:92255631-92255653 GATCACATGGTCCACAAACAGGG + Intergenic
1102996410 12:117354732-117354754 TAGCTCATGGTGTCCAAAACAGG - Intronic
1103130256 12:118462328-118462350 CATGACATGGTACCCCAACCTGG - Intergenic
1103163655 12:118752105-118752127 TGACACATGGTGGCAAAACCAGG + Intergenic
1108435672 13:50399161-50399183 TCACAGATGGTCCCCAAACCAGG - Intronic
1112133326 13:96548206-96548228 CCTCACATGATGACCAAACCTGG + Intronic
1118124755 14:62889362-62889384 CATCACATGGGGGCCAAGCCAGG + Intronic
1118300684 14:64613147-64613169 AATCACATGGTTTGCAAACCCGG + Intergenic
1121257017 14:92538443-92538465 TACCACAGTGTGCCCAAGCCCGG - Intronic
1128998981 15:72317781-72317803 TATCACCTGACGTCCAAACCGGG + Intronic
1134807471 16:17138242-17138264 TATCACATGGTGCCCAAACCTGG - Intronic
1140714975 16:77714975-77714997 TATCACAGGGTGTCCACACAGGG - Intergenic
1143734095 17:8898286-8898308 TATCAAATGGGGAACAAACCTGG - Intronic
1144262522 17:13536493-13536515 TGTCACATGGTTCCAAAAACAGG + Intronic
1151281245 17:73075862-73075884 TATCACATGGTGAGCAGATCTGG - Intronic
1151390696 17:73784903-73784925 AATCTCCTGGTGCCCAAGCCTGG - Intergenic
1152655346 17:81516858-81516880 TCTCACCTGGTCCCCAGACCAGG + Intronic
1152655354 17:81516902-81516924 TCTCACCTGGTCCCCAGACCAGG + Intronic
1155606111 18:27607954-27607976 TATCACATTGATCCCAAACTTGG - Intergenic
1158787154 18:60727985-60728007 TATCACCTGATACCAAAACCAGG - Intergenic
927128541 2:20036391-20036413 TATCACATGGGTACTAAACCTGG - Intronic
927190782 2:20515570-20515592 CATCACAGGGTGTCCAACCCGGG - Intergenic
929557195 2:42932889-42932911 TATCACATGGTGGCAGAACGTGG - Intergenic
932354068 2:71054024-71054046 TATCACAGGGTGTACAAACAGGG + Intergenic
932558908 2:72850202-72850224 TGTCTCATGGTTCTCAAACCTGG - Intergenic
935566736 2:104616928-104616950 TATCACAGGGTGACCAAAGTGGG + Intergenic
937342992 2:121103863-121103885 TTTTAAAGGGTGCCCAAACCAGG + Intergenic
945103073 2:206281098-206281120 TACTGCATGGTTCCCAAACCAGG - Intronic
947838309 2:233190596-233190618 CATCGCCTGGTGCCCAGACCAGG + Intronic
948835452 2:240624061-240624083 GATCAGATGGTGCCCCAAGCAGG - Intronic
1172034473 20:32001605-32001627 TATCAGATGATTCCCAAACCAGG - Exonic
1173261715 20:41442247-41442269 TCTCATATGTTGCCCAGACCAGG - Intronic
1175551493 20:59820801-59820823 TAAAACATGATTCCCAAACCAGG + Intronic
1181741224 22:24923318-24923340 TAAGACATGGTTCCCAAACTGGG - Intronic
1182250634 22:28997313-28997335 TATCACATTGTTTCCAAACGGGG + Intronic
949885176 3:8687039-8687061 TATCACAGGGTGTACAAACAGGG + Intronic
951461595 3:22957094-22957116 TATCAAACTGTGCCAAAACCTGG + Intergenic
952034398 3:29181881-29181903 TATCCCAAGATGCTCAAACCTGG + Intergenic
952584234 3:34872029-34872051 GGTAACATGGTGCCCAATCCAGG + Intergenic
954558033 3:51533665-51533687 TTTCATCTGGTGCCGAAACCTGG - Intergenic
955202635 3:56864598-56864620 AATAACATGGTGAGCAAACCAGG - Intronic
955469058 3:59267241-59267263 TATTAAATGGTAACCAAACCAGG - Intergenic
957043792 3:75358588-75358610 TATCACAGGGTGTACAAACATGG - Intergenic
957045224 3:75368662-75368684 TATCACAGGGTGCACACACATGG - Intergenic
960653536 3:119978503-119978525 TTACATTTGGTGCCCAAACCCGG + Intronic
960915631 3:122691577-122691599 TATCTGATGATGCCCAAACATGG - Intronic
961271123 3:125689569-125689591 TATCACAAGGTGTACACACCGGG + Intergenic
961272849 3:125702218-125702240 TATCACAGGGTGTACAAACATGG + Intergenic
965927471 3:173999706-173999728 TACCACATTTTGCCCAAAGCTGG + Intronic
969729943 4:8948501-8948523 TATCACAGGGTGTACAAACATGG + Intergenic
969789543 4:9482611-9482633 TATCACAGGGTGTACAAACATGG + Intergenic
973626730 4:52779908-52779930 TATCCCACTGTGCCCCAACCTGG - Intergenic
974664105 4:64935788-64935810 TATCACAGAGTGCAAAAACCTGG - Intergenic
976102877 4:81584123-81584145 TATCATCTTGTCCCCAAACCGGG + Intronic
976972124 4:91116737-91116759 TATCACTTGGAGACCAAACAAGG - Intronic
978904636 4:113991260-113991282 TTTCACATGTGGCCCACACCTGG - Intergenic
982641047 4:157961459-157961481 TATCACATGGTCTCCTAAGCAGG - Intergenic
982970567 4:161979750-161979772 TATCTATTGCTGCCCAAACCTGG + Intronic
983028744 4:162771680-162771702 TATCCCATGGTGCTCAAGCAGGG - Intergenic
985017612 4:185652661-185652683 ATTCACATGGTGCACAAGCCGGG - Exonic
985258478 4:188092548-188092570 TATCACTTGGGGCCCAACCCTGG + Intronic
988071453 5:26293871-26293893 CATCACATGTTGTCCAAACCTGG - Intergenic
988866254 5:35338493-35338515 TATCACATGTTACACAAACAAGG + Intergenic
992101916 5:73416167-73416189 AAACACATACTGCCCAAACCTGG + Intergenic
997688073 5:135802854-135802876 TATCACAGGGTGTACAAACATGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1005133712 6:22542275-22542297 TATCATATGGGGGCCAAAGCAGG + Intergenic
1006694505 6:35920363-35920385 AGCCACAGGGTGCCCAAACCCGG + Intronic
1009971116 6:70626837-70626859 TATCACATCGTTTCCAAACTTGG - Intergenic
1010434527 6:75814022-75814044 GGTCACATGCTCCCCAAACCCGG + Intronic
1017619068 6:156276202-156276224 TGCCACATGCTGCCCAATCCTGG + Intergenic
1018581364 6:165310995-165311017 TATCACATGCCCCCCAAAACAGG + Intergenic
1024209590 7:47192117-47192139 CTCCACATGGTGGCCAAACCAGG + Intergenic
1025875334 7:65476238-65476260 TATGTCTTGGTGCCGAAACCGGG + Intergenic
1026146830 7:67753844-67753866 TAACATTTGGTGCCAAAACCTGG - Intergenic
1028789223 7:94834549-94834571 ATGCACATGGTGACCAAACCAGG - Intergenic
1029803368 7:102973612-102973634 TTTCATCTGGTGCCGAAACCCGG + Intronic
1030398980 7:109025017-109025039 CATAACATGGTCCCCAAATCTGG - Intergenic
1033786992 7:144743870-144743892 TACCACATGGTTCACAATCCTGG - Intronic
1038640578 8:29321783-29321805 TATCACAGGGTGTACAAACATGG - Intergenic
1040459347 8:47632294-47632316 TAACACATGGTACCCAGGCCTGG + Intronic
1040618331 8:49062281-49062303 TTTCACATGGTGCCCTTGCCAGG - Intronic
1042147695 8:65748498-65748520 TTTCATCTGGTGCCCAATCCAGG - Intronic
1043516401 8:80998941-80998963 TACCACATGGTTCCCACGCCTGG - Intronic
1046708037 8:117477716-117477738 TATCAGATGCTGCTCAACCCTGG + Intergenic
1049258315 8:141625503-141625525 TGGCCCATGGTGCCCACACCAGG + Intergenic
1050923593 9:11235529-11235551 TATAATTTGGTGCCAAAACCCGG - Intergenic
1051657579 9:19397747-19397769 TATCACACTTTGCCCCAACCTGG + Intergenic
1055979792 9:81990675-81990697 TATCACATTGCCCCCAACCCAGG - Intronic
1056251656 9:84754677-84754699 TTTCACATGGTGCCTAGTCCTGG - Intronic
1056866441 9:90230999-90231021 TATCACAGGGTGTACAAACAGGG + Intergenic
1062207583 9:135345887-135345909 TCACACATGGTTCCCAAACCCGG + Exonic
1185776821 X:2809847-2809869 CATCACATGGTGACCAGACAGGG + Intronic
1187297576 X:18016765-18016787 TATCTCATGGTGCCTAAAGCAGG - Intergenic
1191641832 X:63434544-63434566 TAACATTTGGTGCCAAAACCTGG - Intergenic
1192946520 X:75969384-75969406 TTTCATCTGGTGCCAAAACCCGG - Intergenic
1195215785 X:102700262-102700284 TAACAAATGGTCCCCAAATCTGG - Intergenic
1196458400 X:115905897-115905919 TATCTCATGGTGGCCAGGCCTGG + Intergenic
1197324574 X:125076385-125076407 TAACACATGGGACCCAAAACAGG - Intergenic
1200118974 X:153781549-153781571 TACCACGTGGTGCGCAAACTGGG + Exonic