ID: 1134807568

View in Genome Browser
Species Human (GRCh38)
Location 16:17138923-17138945
Sequence TGGAATTTCACCCCTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134807562_1134807568 26 Left 1134807562 16:17138874-17138896 CCAACAGACAAATCAAAGGGATT No data
Right 1134807568 16:17138923-17138945 TGGAATTTCACCCCTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134807568 Original CRISPR TGGAATTTCACCCCTGGGGT AGG Intronic
No off target data available for this crispr