ID: 1134809532

View in Genome Browser
Species Human (GRCh38)
Location 16:17155536-17155558
Sequence CCCTCCCAAGTGACCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134809532_1134809539 3 Left 1134809532 16:17155536-17155558 CCAGCTCTGGTCACTTGGGAGGG No data
Right 1134809539 16:17155562-17155584 ATGGATGATGGGCTATAGGTAGG No data
1134809532_1134809535 -9 Left 1134809532 16:17155536-17155558 CCAGCTCTGGTCACTTGGGAGGG No data
Right 1134809535 16:17155550-17155572 TTGGGAGGGACCATGGATGATGG No data
1134809532_1134809540 20 Left 1134809532 16:17155536-17155558 CCAGCTCTGGTCACTTGGGAGGG No data
Right 1134809540 16:17155579-17155601 GGTAGGCTTATTCGTGCAGCAGG No data
1134809532_1134809541 25 Left 1134809532 16:17155536-17155558 CCAGCTCTGGTCACTTGGGAGGG No data
Right 1134809541 16:17155584-17155606 GCTTATTCGTGCAGCAGGTGAGG No data
1134809532_1134809536 -8 Left 1134809532 16:17155536-17155558 CCAGCTCTGGTCACTTGGGAGGG No data
Right 1134809536 16:17155551-17155573 TGGGAGGGACCATGGATGATGGG No data
1134809532_1134809537 -1 Left 1134809532 16:17155536-17155558 CCAGCTCTGGTCACTTGGGAGGG No data
Right 1134809537 16:17155558-17155580 GACCATGGATGATGGGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134809532 Original CRISPR CCCTCCCAAGTGACCAGAGC TGG (reversed) Intronic
No off target data available for this crispr