ID: 1134810036

View in Genome Browser
Species Human (GRCh38)
Location 16:17159509-17159531
Sequence CAGCTGGATTTGTTCAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134810032_1134810036 -7 Left 1134810032 16:17159493-17159515 CCACGAGGACAGAGCCCAGCTGG No data
Right 1134810036 16:17159509-17159531 CAGCTGGATTTGTTCAACACTGG 0: 1
1: 0
2: 4
3: 14
4: 153
1134810030_1134810036 18 Left 1134810030 16:17159468-17159490 CCTTGCTTACATTAGAATGTAAG No data
Right 1134810036 16:17159509-17159531 CAGCTGGATTTGTTCAACACTGG 0: 1
1: 0
2: 4
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134810036 Original CRISPR CAGCTGGATTTGTTCAACAC TGG Intronic
905696973 1:39981720-39981742 CAGGAGGATTTGTTGAGCACAGG - Intergenic
906269851 1:44468148-44468170 CTGATAGATTTGCTCAACACAGG + Intronic
912161512 1:106991464-106991486 CAGCAAGATTTGTTTAAAACTGG + Intergenic
914452662 1:147806521-147806543 CAGCTAGATTTATTTAGCACTGG + Intergenic
914975158 1:152354468-152354490 CATCTGGATTTGGACAACACAGG - Exonic
914975186 1:152354699-152354721 CAACTGGCTTTGGACAACACAGG - Exonic
914975242 1:152355161-152355183 CATCTGGCTTTGGACAACACAGG - Exonic
915212881 1:154323486-154323508 CATCTGGCTTTGTGCAACACAGG - Intronic
915778209 1:158514995-158515017 CTGCTGGATTTCTTCAAGGCTGG - Intergenic
919971077 1:202579394-202579416 CATCTGTATCTGTTCAATACAGG - Intronic
921649165 1:217656361-217656383 CAACTGGATTTGATCAAAAATGG + Intronic
922328601 1:224553925-224553947 CAGATGGATTTGTTCTACAGAGG - Intronic
923512195 1:234662228-234662250 CACCTGGTTTTGTGGAACACAGG + Intergenic
924904754 1:248440596-248440618 CAGCTCTTTTTATTCAACACAGG + Intergenic
924923133 1:248651453-248651475 CAGCTCTTTTTATTCAACACAGG - Intergenic
1064513219 10:16117839-16117861 CAGCTGTATTTGATACACACAGG - Intergenic
1066057179 10:31692930-31692952 CAGATAGACTTGTTCTACACAGG + Intergenic
1069647435 10:70012559-70012581 CTGCTGGATCTGTTCATTACTGG - Intergenic
1071714340 10:88080041-88080063 AAGCTGGATTTGTCCAACACAGG + Intergenic
1071933421 10:90499385-90499407 CAGAGGCAATTGTTCAACACAGG + Intergenic
1072802520 10:98403039-98403061 CCGCTGGAGTTGCTCCACACTGG + Intronic
1080704222 11:34674268-34674290 CAGGAGGATTTCTTCAACCCAGG - Intergenic
1081124524 11:39306717-39306739 CAGCTGGATTTATGCATGACAGG - Intergenic
1085310284 11:75512413-75512435 CTGCTGCATGTGTTCAACTCTGG - Intronic
1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG + Intergenic
1086436312 11:86784359-86784381 CAGCTGGATTTGTGAAGCCCAGG - Intergenic
1087250553 11:95894031-95894053 CAGCTGGATATGTAGAACAAGGG - Intronic
1090079828 11:123604703-123604725 CATCTGGATTTGTTAAGTACAGG + Intronic
1090189187 11:124757425-124757447 CAGCTGGATTTTTTTGAGACAGG - Intronic
1092521923 12:9284387-9284409 CAGCTGGTTGGGTTCCACACAGG + Intergenic
1092545360 12:9447469-9447491 CAGCTGGTTGGGTTCCACACAGG - Intergenic
1094591543 12:31826361-31826383 CAGGTGGATTTGTTGAGCTCAGG + Intergenic
1094813802 12:34165296-34165318 CAGCTGCATTTCTTCATGACTGG - Intergenic
1095918644 12:47506747-47506769 CAGCTGGATTTGCACAACAGGGG + Intergenic
1095973530 12:47923014-47923036 CAAGTAGATTTCTTCAACACAGG + Intronic
1099754070 12:86818609-86818631 CATGTGGATTTATTCCACACGGG - Intronic
1102028135 12:109725093-109725115 CAGCTGGAGTTGCTCAGCCCAGG - Intronic
1102145434 12:110651544-110651566 CATCTGGATTTGTCCACCAGAGG - Intronic
1102510510 12:113412199-113412221 CAGGTGGATTTGTTGAGCCCAGG - Intronic
1105053060 12:133072191-133072213 CAGCAGGATCACTTCAACACAGG - Intergenic
1106159330 13:27186427-27186449 CATCTGGTTTTCTTCAATACTGG + Intergenic
1106958036 13:34964812-34964834 CAGCTGGATCAGGTTAACACTGG + Intronic
1107283187 13:38759507-38759529 CAGCTGGATAAGTTCAAAAGAGG + Intronic
1109935650 13:69280619-69280641 CAGCTACATTCGTTCAGCACAGG - Intergenic
1110573495 13:77030711-77030733 CAGCTGGATTACTTAAACTCAGG + Intergenic
1111615524 13:90657728-90657750 CAGGTGGATTGCTTCAACCCAGG - Intergenic
1118848192 14:69564120-69564142 AAGCTGACTTTGCTCAACACTGG + Intergenic
1119369618 14:74128233-74128255 CAGCTCCATTTCTTCAACTCAGG - Intronic
1119705270 14:76779310-76779332 CACATGGATTTGTTAAGCACTGG - Exonic
1122838042 14:104440880-104440902 CTGATTGACTTGTTCAACACAGG + Intergenic
1124690146 15:31815050-31815072 CAACTGGGTTTCTTCAACATTGG + Intronic
1124933038 15:34142517-34142539 TATCTGCATTTGTTCAGCACAGG + Intronic
1126146599 15:45479263-45479285 CAGCTGGATTGCTTGAACCCAGG - Intergenic
1129748380 15:78041306-78041328 CAGCTGGGTTTGTTCCTCACTGG - Intronic
1130197290 15:81792491-81792513 CAGCTGGATTTGTTCAAAATAGG - Intergenic
1132604326 16:787445-787467 CAGCTGGATTTCTCCACCAGCGG - Exonic
1133997372 16:10758746-10758768 CAGCTGGTTCTGTTGAAAACTGG - Intronic
1134190568 16:12118002-12118024 CAGGAGGATTGCTTCAACACGGG + Intronic
1134283554 16:12839607-12839629 CAGGAGGATTTTTTCAACCCGGG - Intergenic
1134810036 16:17159509-17159531 CAGCTGGATTTGTTCAACACTGG + Intronic
1135420072 16:22299803-22299825 CAGCAGGATTGGTTGAACCCAGG - Intronic
1138146923 16:54620904-54620926 AAGCTGAATTCTTTCAACACAGG + Intergenic
1146238210 17:31187531-31187553 CAGCTGGATTGGTAGAACAGTGG + Intronic
1148797323 17:50203264-50203286 CAGCTGGTTTTGTGCAACGAAGG + Intergenic
1151932785 17:77243135-77243157 CAGCTGGGTTTGTTCAAAACAGG + Intergenic
1153874721 18:9358942-9358964 CAGTTGGGTTTGTTCAGGACTGG + Intronic
1155005003 18:21720860-21720882 CAGGAGGATTGCTTCAACACAGG + Intronic
1155934040 18:31736779-31736801 CAGCTGAATATGATCAAAACTGG + Intergenic
1156412069 18:36840087-36840109 CAGCTGTATCTTTTCAACTCAGG + Intronic
1157146265 18:45165793-45165815 CAGCAGGATTGTTTCAACACTGG + Intergenic
1158763049 18:60413628-60413650 CAGGTGGATTTATTCTACAGGGG + Intergenic
1160096629 18:75879165-75879187 GAGCTGGATTTAGTGAACACAGG - Intergenic
1161031275 19:2058775-2058797 CGGCTGGATGTGTGCAACAAGGG + Intergenic
1166210517 19:41303950-41303972 CATCTGGATTTCTCCAACACAGG + Exonic
1168025242 19:53639072-53639094 CAGGTGGATTGCTTCAACTCAGG + Intergenic
925762389 2:7198092-7198114 CAAGGGGACTTGTTCAACACTGG + Intergenic
929454712 2:42057608-42057630 CAGCTGGTCTTTTTCAAGACTGG + Exonic
936224957 2:110640412-110640434 CAGTTGGTTTTGTTAAACCCAGG + Intronic
937959705 2:127447261-127447283 CAGCTGGATCTGTTAAATAGAGG + Intronic
940202939 2:151171347-151171369 CATCTGGATCTGTTTAACAGTGG - Intergenic
940701933 2:157056234-157056256 CAGCTGTGTTTGTTCATCAGGGG - Intergenic
942108297 2:172655330-172655352 AACCACGATTTGTTCAACACTGG - Intergenic
943272292 2:185821831-185821853 CAGGTGGATTTATTGAGCACAGG + Intronic
945069338 2:205975307-205975329 CAGCTGCAATTCTTCAAGACAGG + Intergenic
946829425 2:223712670-223712692 AAGCAGGATTTGCTCAACATGGG + Intergenic
947738442 2:232472957-232472979 CACTTGGATTTGTTCTTCACTGG + Intergenic
947742467 2:232490923-232490945 CAGCTGGATCTGTCCTCCACTGG + Intergenic
1168814049 20:724574-724596 GAGCTGCATTTGTGGAACACTGG + Intergenic
1172199265 20:33113777-33113799 GAGCAGGATTTGTTCAAAAGAGG - Intergenic
1173819975 20:46013512-46013534 CAGCTGTATTTGTTCAAGGATGG + Exonic
1177016144 21:15789937-15789959 AAACTGAATTTGTTCAAGACTGG - Intronic
1181118731 22:20650874-20650896 CAGCTGGATCTTTTCTCCACGGG + Intergenic
1182947888 22:34342106-34342128 CAGCTGGATTTGACCCAGACAGG + Intergenic
1183109154 22:35636120-35636142 CAGCTGGATTACTTGAACACAGG - Intronic
1184199414 22:42956098-42956120 CATCAGGATTTGTTCTACAGTGG - Intronic
950100400 3:10353063-10353085 CAGCTAGACTTGTTCCACAGTGG - Intronic
951384700 3:22028803-22028825 CAGCTGGATTTATAAAACATTGG + Intronic
952407220 3:33015421-33015443 CTGCTCTATTTGTTCCACACAGG + Intronic
960510973 3:118548540-118548562 CAACTGGAAGTGGTCAACACCGG + Intergenic
962272670 3:133989472-133989494 CCCCTGGATTTGAGCAACACTGG + Intronic
962679667 3:137785131-137785153 CACCTGGAGTTTCTCAACACAGG - Intergenic
967356583 3:188578641-188578663 CAACTTGATTTGTTCAACTAAGG + Intronic
970852562 4:20618430-20618452 CAGCTGGTTTTGTTTACCACAGG - Intronic
973325646 4:48858213-48858235 CAGCAAGATTAGTTTAACACAGG + Intronic
974102319 4:57430620-57430642 CACCTGGATATTTTCTACACTGG + Intergenic
974164090 4:58178233-58178255 CAGGAGAATTTGTTCAACCCTGG - Intergenic
974869048 4:67615728-67615750 TAGCTGCATTTGTTCAAGATGGG - Exonic
976426739 4:84912839-84912861 CAACTGCATTTGCTCAAAACAGG - Intronic
979233759 4:118376006-118376028 CAGGTGGATTTGTTGAACTCAGG + Intergenic
979342016 4:119536121-119536143 CAGCTGGTTTTGAACAATACTGG + Intronic
980980182 4:139648264-139648286 CAGATAGACTTGCTCAACACAGG + Intergenic
982236070 4:153252260-153252282 TAGCTGGCTTTGTTCTACTCTGG + Intronic
983124695 4:163936320-163936342 CAGATAGACTTGCTCAACACAGG + Intronic
984280768 4:177667675-177667697 CAGCTGGATTGCTTCATCTCAGG + Intergenic
986589332 5:9352833-9352855 TGGCTGGATTTGTGCTACACTGG + Intronic
986752561 5:10801980-10802002 CAGCTGGATTTTCTGATCACAGG - Intergenic
987885623 5:23807793-23807815 CAGCTGGATTGGTAGAACAGTGG + Intergenic
989089863 5:37719057-37719079 CAGATGGATTTCTTCTACATAGG + Intronic
989487180 5:42004970-42004992 TAGCTGGTTATTTTCAACACTGG + Intergenic
990246657 5:53870011-53870033 CAGCTGGGTGTTTTCACCACTGG - Intergenic
993530046 5:89013178-89013200 GAGCTGGATTTTTTCAAAATGGG + Intergenic
993710848 5:91223314-91223336 CATCTGCATTTTTTAAACACTGG - Intergenic
994625907 5:102218648-102218670 CTGATAGAGTTGTTCAACACAGG - Intergenic
996735820 5:126757056-126757078 CAGCTGGATTGCTTGAACTCAGG + Intergenic
997652407 5:135532196-135532218 CAGCTGCATATGTGCAGCACTGG - Intergenic
998888679 5:146722790-146722812 AAACTGGGTTTCTTCAACACTGG - Intronic
999207917 5:149863335-149863357 CAGCTGGAAACGTCCAACACTGG + Intronic
1000247565 5:159461380-159461402 CAACTGCATTACTTCAACACAGG + Intergenic
1001491512 5:172159236-172159258 CATGTGTACTTGTTCAACACTGG - Intronic
1002914086 6:1515234-1515256 CAGCTGGATCTGCTCATCTCGGG - Intergenic
1003555449 6:7135897-7135919 AAGCTGGATTTTTACTACACAGG + Intronic
1004906584 6:20242283-20242305 CAGGTGGATATGTTCACCAATGG + Intergenic
1006550420 6:34818239-34818261 CAGGTGGATTGCTTCAACCCAGG + Intronic
1010750476 6:79611762-79611784 AATCTGGATTTGCCCAACACTGG - Intergenic
1013168792 6:107617727-107617749 CAGCTTGATTTGATCATCCCAGG + Intronic
1013594876 6:111651441-111651463 CAGCTGGGGTAGTTCAACATGGG + Intergenic
1014561808 6:122900181-122900203 TAGTTGGATTTGTTCAGCACTGG - Intergenic
1015862498 6:137695622-137695644 CACCTGCCTTTGTTCACCACTGG + Intergenic
1016660690 6:146575687-146575709 CAGGTGGATTGCTTCAACACAGG - Intergenic
1017148691 6:151258371-151258393 CAGCTGGCTTTTTTCAGCATTGG + Intronic
1020057501 7:5128120-5128142 CAGGAGAATTTGTTCAACCCAGG + Intergenic
1021606911 7:22417586-22417608 CAGATGGATTTGATAAACCCTGG - Intergenic
1023121608 7:36915044-36915066 CACCTGGATTGCTTCAACCCAGG - Intronic
1023352562 7:39334936-39334958 CAGCTGGATTTGTCCCTAACTGG - Intronic
1023411554 7:39893498-39893520 CAGGTGGATTTCTTGAACCCAGG + Intergenic
1023445974 7:40232006-40232028 CAGGTGGATTGCTTCAACCCAGG + Intronic
1026459276 7:70599264-70599286 CAGGTGAGTGTGTTCAACACAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030864802 7:114687208-114687230 CAACTGGATTTGTAGAACATAGG - Intronic
1030883103 7:114905260-114905282 CAGCTGGATTGGTAGAACAGAGG - Intergenic
1031631208 7:124045402-124045424 CAGCTAGATGTTTTCAGCACTGG - Intergenic
1031964018 7:128014382-128014404 CATCTAGATTTGATCTACACTGG + Intronic
1032848567 7:135772776-135772798 CAGCTGGGTTTTTTCTACTCGGG + Intergenic
1033014439 7:137657875-137657897 CAGCTGCATTCATTCAACATGGG + Intronic
1033354066 7:140585451-140585473 CTCCTGGATTTGTACAACGCTGG - Intronic
1038004318 8:23417027-23417049 CAGCTGGCTGTGACCAACACTGG + Intronic
1040659160 8:49549053-49549075 CAGCAGGATTTGATCAAAACAGG - Intronic
1042521411 8:69715468-69715490 CTGCTGGATTTGGACAACAATGG - Intronic
1044864932 8:96561736-96561758 CAGCTGGATTCTTTCACTACTGG - Intronic
1046418325 8:113944336-113944358 CAGCTGGGTTTGTTCAAGAGAGG + Intergenic
1046989483 8:120435109-120435131 CAAGTGGATTTGTTCATCAATGG - Intronic
1048145962 8:131843613-131843635 CAGCGGGCTCTGTTCCACACAGG + Intergenic
1051902583 9:22059296-22059318 CAGCTGTATTTACTCAATACTGG - Intergenic
1053354489 9:37434355-37434377 CAGCTTGAATTGTTCCCCACAGG - Intronic
1055995870 9:82159333-82159355 CAGCTGGATTTGTCTAAGTCAGG + Intergenic
1058259088 9:102808404-102808426 CAGCTGGATTGGTAGAACAGTGG - Intergenic
1060765278 9:126291110-126291132 CAGCTGGAATGGTGCAGCACTGG + Intergenic
1061486932 9:130924759-130924781 CAGCTGGATTTGCCCAACACGGG - Intronic
1193683898 X:84554251-84554273 CAGCTGCATATGTTCTACAATGG + Intergenic
1194552673 X:95320839-95320861 CAGCTGGATACCATCAACACAGG - Intergenic
1196063657 X:111438821-111438843 CAGGTGGATCTGTTGAACTCAGG - Intergenic
1197970303 X:132108622-132108644 CACCAGGATTTGTCCAAGACAGG - Intronic