ID: 1134812458

View in Genome Browser
Species Human (GRCh38)
Location 16:17179223-17179245
Sequence CAGGGTCTCCTTGAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134812458 Original CRISPR CAGGGTCTCCTTGAGGAGGC AGG Intronic
900382959 1:2394234-2394256 CTCGGTCTCCTTGAGCAGCCTGG + Intronic
901418910 1:9137091-9137113 CAGGGCCCCCTTGGGGATGCTGG - Intergenic
901617645 1:10554467-10554489 CCAGGTCACCTTGAAGAGGCAGG + Intronic
901631709 1:10651294-10651316 CAGGGCCTCCTGGAGGAGAAGGG + Intronic
901943636 1:12683473-12683495 AAGGGTCACTTTGATGAGGCAGG - Intergenic
902856051 1:19206310-19206332 CAGGGTCTCCTTCTGTTGGCTGG - Intronic
902942611 1:19811524-19811546 CAGGGCCTCCGTGAGGATTCAGG - Intergenic
904170901 1:28591886-28591908 CACAGTCTGGTTGAGGAGGCAGG - Intronic
904272007 1:29356268-29356290 AAGGGTCTCCCTGAGGTGACTGG - Intergenic
904272906 1:29362186-29362208 CAGGGCCTCCGGGAGGAGGCTGG + Intergenic
905397834 1:37678583-37678605 CAGGCTCTCCTTGGGCAAGCAGG + Intergenic
905450208 1:38051324-38051346 CAGCGTCTCCTGGAGGCAGCTGG + Intergenic
905572561 1:39017251-39017273 CAGGGCCTGGTGGAGGAGGCTGG + Intergenic
906169971 1:43716733-43716755 TAGGGACTGCATGAGGAGGCCGG + Intronic
907770213 1:57454492-57454514 CGGGGTCTACTTGAGGATGGAGG + Intronic
908040870 1:60111506-60111528 TAGGGCCTACTTGAGCAGGCAGG + Intergenic
911314337 1:96338018-96338040 CAGGGTCTACTTGAGGATGGAGG + Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
914348848 1:146822445-146822467 CAGGGTCTCCTGGAGCATGGCGG + Intergenic
914444212 1:147736073-147736095 CAGGGTCTCCCTGTGGTGTCCGG + Intergenic
915230901 1:154444704-154444726 CAGGGTCTCCTTATGGTGCCCGG - Intronic
915630583 1:157151301-157151323 CAGGCCCTCGCTGAGGAGGCAGG + Intergenic
916507423 1:165440732-165440754 CAGGGGCTCCCAGAGGAAGCTGG - Intronic
916675358 1:167060680-167060702 AAGAGTCTCCCTGTGGAGGCAGG + Intronic
917863766 1:179173943-179173965 CAGGGTTTTCTTGAGAAGGTAGG - Intronic
918150245 1:181792024-181792046 GAGGGTGTTCTTGATGAGGCAGG + Intronic
919913139 1:202124039-202124061 CAGGCACTCCTTCAGGAGGCAGG - Intronic
920198844 1:204246943-204246965 CAGGGTCTCCCTGTGTTGGCCGG - Intronic
920963776 1:210685746-210685768 CAGGGCCTCTTGGAGGAGGTAGG - Intronic
921372255 1:214436231-214436253 CAGGGCCTACTTGAGGATGGAGG + Intronic
921803901 1:219432654-219432676 GAGGGTCTCCTTGGGAAAGCAGG + Intergenic
922088065 1:222369762-222369784 CAGGGTCTCCAGGAAGAGTCAGG + Intergenic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
922676940 1:227559115-227559137 CAGGGCCCCTTTGAGCAGGCTGG - Intergenic
923813605 1:237348179-237348201 CAGGGTCTCATTGTCCAGGCTGG + Intronic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1064138782 10:12772733-12772755 CAGGTTGTCCTGGAGGAGGCTGG + Intronic
1066218091 10:33308198-33308220 CAGGGTCTACTTGAGGATGGAGG + Intronic
1066462700 10:35625449-35625471 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1067905370 10:50285299-50285321 CAGGGTGGCCTTGAGGAAGTGGG - Intergenic
1069777615 10:70936095-70936117 CAGAGCCTCCTTCAGGAGACAGG + Intergenic
1069957137 10:72059155-72059177 CAGGGTCCCCAAGTGGAGGCGGG + Exonic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1070614788 10:77961402-77961424 CAGGGTCTCCATGGGGAGCAGGG - Intergenic
1072107716 10:92290643-92290665 GAGGTTCTTCTTGAGGGGGCGGG - Intronic
1072675890 10:97465842-97465864 CAGTGTCTCCTTGACGATGCTGG + Exonic
1073185619 10:101613642-101613664 CAGGGTCTCAGTGAGGTGGAAGG - Intronic
1074533417 10:114312030-114312052 AAGGGTCTCTCTGTGGAGGCTGG + Intronic
1075684555 10:124354383-124354405 CAGGGTCTGCTTTAGGAGTGAGG + Intergenic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1076182915 10:128424628-128424650 CAGGGAGTCCTCCAGGAGGCTGG - Intergenic
1076634970 10:131875932-131875954 CAGGCTCTCCTTCCGGTGGCCGG + Intergenic
1076688417 10:132208543-132208565 GAGGGCCTCCTGGAGGAGGTGGG - Intronic
1076749933 10:132537570-132537592 CTTGGTGTCCTTGTGGAGGCGGG - Intergenic
1076850340 10:133089282-133089304 CAGGGTGGCGTGGAGGAGGCCGG - Intronic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077296866 11:1830451-1830473 CAGGGTCTCCATGAGGCTGCTGG + Intronic
1077337407 11:2011586-2011608 CAGGGTCTCCTCCAGGCGACTGG - Intergenic
1077383306 11:2257452-2257474 CGGGGTACCCTGGAGGAGGCAGG - Intergenic
1078281066 11:9901672-9901694 CAGGGTCTCACTCTGGAGGCTGG + Intronic
1079082036 11:17420469-17420491 CTGGGTTTCCTGGAGGAGGCAGG - Intronic
1079152754 11:17915740-17915762 CAGGATCTCCTAGAGCAGGCAGG + Intronic
1081252280 11:40850604-40850626 CAGGACCCACTTGAGGAGGCAGG + Intronic
1081652518 11:44833921-44833943 CAGGCTCTCTTTGGGCAGGCAGG - Intronic
1081743854 11:45459415-45459437 CAGGGTCTCCTGCAAGAGCCGGG + Intergenic
1082842593 11:57701098-57701120 AAGGGCCTCTTTGTGGAGGCTGG - Exonic
1083590632 11:63891879-63891901 TAGGGTACCCTTCAGGAGGCTGG + Intronic
1084061359 11:66677604-66677626 CCGGGTCTCCGGAAGGAGGCGGG - Exonic
1084225805 11:67714087-67714109 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
1084263628 11:67993944-67993966 CAGGGTCTCCACCAGGGGGCAGG - Intronic
1084559404 11:69894277-69894299 CAGTGTCTGCTTGAGCCGGCAGG - Intergenic
1084701451 11:70788789-70788811 CAGGGTGTCCTATAGGAGACAGG + Intronic
1084809781 11:71605177-71605199 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
1089157563 11:116414065-116414087 TAGGTTCTCCTTGGGTAGGCTGG - Intergenic
1089775362 11:120831942-120831964 CCGGATCTCCTTGAGGAGCGGGG - Exonic
1090898499 11:131003502-131003524 CAGGGTCTCCTTGAGGACAAAGG - Intergenic
1202820391 11_KI270721v1_random:66768-66790 CAGGGTCTCCTCCAGGCGACTGG - Intergenic
1092003794 12:5052040-5052062 CTGGGGATCCTGGAGGAGGCAGG + Intergenic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092503085 12:9066405-9066427 CAGGCTCTCCATGAGGTGGCTGG - Intergenic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096549388 12:52362328-52362350 CTGGTACTCCTTGAGCAGGCAGG + Exonic
1097063087 12:56300363-56300385 CGGGGCCTCCTTGAGGACCCCGG - Exonic
1099432468 12:82604343-82604365 CAGGAACTACTAGAGGAGGCAGG + Intergenic
1100308610 12:93374235-93374257 CAGGGTAGCTTGGAGGAGGCAGG - Intergenic
1100472536 12:94906200-94906222 TAGGGTCTCCCTGACAAGGCTGG + Intronic
1100660986 12:96698665-96698687 CAGGGCCTGCTTGAGGGTGCAGG + Intronic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1102742870 12:115223549-115223571 CAGGGTGGCCTGGAGGAAGCTGG + Intergenic
1102937664 12:116911206-116911228 CAGCGTCTCCTGGAGGGCGCGGG + Exonic
1103623712 12:122203915-122203937 CAGGGTCCCCGCGAGGACGCCGG + Intronic
1104512389 12:129392469-129392491 CAGAATCTCTTTGAGGAGGAAGG - Intronic
1104657999 12:130588166-130588188 AAGGGCTTCCTGGAGGAGGCAGG - Intronic
1105707977 13:22980596-22980618 CTGTGTCTCCTGGAGGAGGCTGG + Intergenic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1106582882 13:31032774-31032796 CAGGAGCTCCTTGAGGAGCATGG - Intergenic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1107114842 13:36735364-36735386 CAGGGTCTCCATGGGAAGGGAGG + Intergenic
1109219407 13:59626072-59626094 CAGTGTCCCCATGAGGATGCTGG - Intergenic
1109653086 13:65353910-65353932 CAGTGTCTACTGGAGTAGGCTGG - Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1110033199 13:70644282-70644304 AAATGTCTCCTGGAGGAGGCGGG + Intergenic
1110992054 13:82054572-82054594 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1111485248 13:88889346-88889368 TAAGGTCTACTTGAGGAGGAGGG - Intergenic
1114212716 14:20629006-20629028 CAGGATGTCCTTGATGAGGGAGG - Intergenic
1114660527 14:24340689-24340711 CAGGAGCTCCTGGAGGTGGCAGG + Intergenic
1115439826 14:33421117-33421139 CAGCGTCTCCTTGAGGCTTCAGG - Intronic
1118732238 14:68676658-68676680 CAGGCGCTTCTGGAGGAGGCAGG + Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119131531 14:72177343-72177365 CAGGGTGTCTTTGAGCAGGGAGG + Intronic
1120377852 14:83732320-83732342 TGGGGTCTACTTGAGGAGGGAGG + Intergenic
1120846943 14:89134432-89134454 TAGGGTTTTCTTGTGGAGGCTGG + Intronic
1121410228 14:93744390-93744412 CAGGGTGCCCTTGCGGAGGCCGG + Intronic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1122113896 14:99518301-99518323 CCTGGTCTCCATGTGGAGGCGGG - Intronic
1122229264 14:100297379-100297401 CAGGGGCTGCCTGAGGGGGCCGG + Intronic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1122887987 14:104719039-104719061 CAGGGTTGCCTTTAGGAAGCAGG - Exonic
1122984423 14:105205667-105205689 CAGTGTGTCCTCGTGGAGGCTGG - Intergenic
1128248330 15:66148184-66148206 CAGGGACTCCCTGAGTGGGCAGG + Intronic
1128371478 15:67042792-67042814 CAGGGACCCCTTGAGGGAGCTGG + Intergenic
1129178697 15:73858004-73858026 GAGGGTTCCCTTGAGAAGGCAGG + Intergenic
1129390092 15:75216042-75216064 CAGGGTCCCCTTCTGGAGCCTGG + Intergenic
1129932854 15:79426651-79426673 CATGGTCCCCTTCAGAAGGCTGG - Intronic
1130113684 15:80987931-80987953 CAGGGTCTCCTTATGTTGGCTGG - Intronic
1131483501 15:92801687-92801709 CAGGGTCCCCTTCAGCAGCCTGG - Intronic
1132470478 16:100088-100110 CTGAGTGTCCTTGGGGAGGCCGG - Intronic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1133548730 16:6833485-6833507 GAGGGTCTCCCTGAGAAGGTGGG - Intronic
1134793724 16:17014733-17014755 CAGGGCCTACTTGAGCAGGGAGG - Intergenic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1136121973 16:28142899-28142921 CAGGGTCTCATTATGTAGGCCGG + Intronic
1136192280 16:28623597-28623619 CAGGAGCTCCTGGAGGAGGCAGG - Intronic
1136383303 16:29907070-29907092 CAGGGTCTCCTCGAAGATCCGGG + Exonic
1136593110 16:31229565-31229587 CAGGGTCTCCCTGGGGATGTAGG + Intergenic
1136677494 16:31925032-31925054 CAGAGTCTCCTTGGAGAGGGAGG + Intergenic
1138119808 16:54390870-54390892 CTGGGTCTCCTTCAGCAGACAGG - Intergenic
1138205075 16:55118755-55118777 CAGGGCCTCTCTGGGGAGGCTGG - Intergenic
1138760688 16:59540305-59540327 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1139154189 16:64421303-64421325 CAGGGTCTACTTGAGGGTGTAGG - Intergenic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1139985188 16:70893110-70893132 CAGGGTCTCCTGGAGCATGGCGG - Intronic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1141813401 16:86391973-86391995 CAGTGTCTGCTGGAGGAGGCAGG - Intergenic
1142108380 16:88318333-88318355 CAGCGTCTCCAGGAGGAGGCTGG - Intergenic
1142265482 16:89062348-89062370 CAGGGTCTCCTGGTGGTGGTGGG + Intergenic
1143379919 17:6489597-6489619 AAGAGTCTCTCTGAGGAGGCAGG - Intronic
1143380691 17:6494309-6494331 AAGAGTCTCCCTGAGGAGGCAGG - Intronic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1144428057 17:15163650-15163672 CAGGGTCTACTTGAGGATTGAGG + Intergenic
1144554262 17:16267886-16267908 CAGGCTCTCCTGGTGGAGGCAGG + Intronic
1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG + Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1146150270 17:30462660-30462682 TAGGGTCTCCTTGATGGAGCTGG - Intronic
1147160195 17:38565033-38565055 CAGAGGCTCCTGGGGGAGGCTGG - Intronic
1147342810 17:39764703-39764725 GAGGTTCTCCTTGATCAGGCAGG - Intergenic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1147886178 17:43685908-43685930 CAGGGTCTCGTTGTCCAGGCTGG + Intergenic
1148641317 17:49189807-49189829 CAGGAGCCACTTGAGGAGGCTGG + Intergenic
1148751403 17:49947616-49947638 CAGGGACTCTGTGAGGAGGGTGG - Intergenic
1150069028 17:62137038-62137060 CAGTGTCTCCTTCAGCTGGCTGG + Intergenic
1150171462 17:63000067-63000089 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1150856345 17:68756747-68756769 GAGGGCTTCCTTGAGGAAGCAGG + Intergenic
1151230238 17:72679571-72679593 CAAGGGCTCCTGGAGGAAGCTGG + Intronic
1151530118 17:74698693-74698715 CAGGGCCTACTTGAGGATGGAGG + Intronic
1151535530 17:74737065-74737087 CAGGGTCTGCGTGAAGGGGCGGG - Exonic
1152719182 17:81914560-81914582 CAGGGTCTCCATGGGCAGGCGGG - Intronic
1152738437 17:82008703-82008725 CAGGGTCTCCATGGGGGGGAGGG - Intronic
1153227707 18:2910627-2910649 CAGGGCCTCCTGGAGGGGGGTGG + Intronic
1153532183 18:6058436-6058458 CATAGTCTCCTTGGGGAGACAGG - Intronic
1153790177 18:8571655-8571677 CAGGGGTTCCCTGTGGAGGCTGG - Intergenic
1153941506 18:9982492-9982514 TAGGGTCTCCTTGACCAAGCTGG + Intergenic
1155262509 18:24058148-24058170 CAGGGTCTACTTGAGGGTGGAGG + Intronic
1155777870 18:29791158-29791180 TAGGGTCTGCTTGAGGAAGGAGG - Intergenic
1155931282 18:31711411-31711433 CTGGGTCTACTTGAGGATGGAGG - Intergenic
1156450162 18:37262321-37262343 CAGCCTCTCCTTGGGGTGGCAGG - Intronic
1156521285 18:37724187-37724209 CAGGGTACCCTTTAGGAAGCTGG - Intergenic
1157281141 18:46347095-46347117 GAGGGCCTCCCGGAGGAGGCAGG + Intronic
1157426311 18:47587390-47587412 CAGGGTCTCATGCAGGAGACAGG + Intergenic
1157911234 18:51619114-51619136 CAAGATCTCCTTAAGGAGACTGG - Intergenic
1158331900 18:56371593-56371615 CTGTTTCTCCTTGAGGAGGGAGG - Intergenic
1158566860 18:58561470-58561492 CAGGGTCTGCTTTTGGGGGCGGG - Intronic
1159886671 18:73914245-73914267 CAGGCTCCCCATGGGGAGGCAGG - Intergenic
1160363391 18:78303593-78303615 CAAAGTCTCCATGAGGAAGCGGG + Intergenic
1160531985 18:79571184-79571206 CTGGGTTTCCCTGAGGGGGCCGG - Intergenic
1160725829 19:617438-617460 CAGTGTCTCCTTCAGCTGGCTGG + Exonic
1162066039 19:8126091-8126113 CAAGTTGTCCTTGAGGAGGAAGG + Intronic
1162220232 19:9170196-9170218 CAGGGTCTCATGGAGCAAGCTGG - Intergenic
1164131849 19:22370492-22370514 CGTGCTCTCCTTGAGCAGGCCGG - Intergenic
1164455611 19:28404134-28404156 CAGGGTGTACATGGGGAGGCTGG + Intergenic
1166551723 19:43670009-43670031 CAGGGTCTAATTGAGGGGGTTGG - Intronic
1166688458 19:44809476-44809498 CAGGGTCTGAGGGAGGAGGCAGG - Intronic
1166976325 19:46607182-46607204 AAGAGTCTCTTTGGGGAGGCTGG - Intronic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1167455907 19:49596670-49596692 CATGGCCTCCTTCTGGAGGCCGG + Exonic
1167471121 19:49677038-49677060 CCGGGTCGACTTGAGGGGGCGGG + Intronic
1168723415 19:58567673-58567695 AAGGGTCTCCTTGGGGAGTGGGG + Intronic
924966461 2:81007-81029 CAGAGTCTCCTTCAGGTGGGGGG - Intergenic
925322512 2:2985423-2985445 CAGGGACTACTAGAGGAGGGAGG + Intergenic
926803985 2:16687792-16687814 CAGGGTCTCAGTGAGGACGGAGG - Intergenic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
927982766 2:27384926-27384948 CAGGGCCTCAATGGGGAGGCAGG - Exonic
928433450 2:31238909-31238931 CCCGGGCTCCTTGGGGAGGCTGG + Intronic
929429743 2:41877239-41877261 CTGGGACCCCTTGAGGAGGTGGG - Intergenic
930028987 2:47046993-47047015 CAGGGTCTCCAGCAGGAGACAGG - Intronic
931778023 2:65556667-65556689 CAGCCTCTCCTTGCGGAAGCAGG + Intergenic
932683643 2:73849301-73849323 TGAGGTCTGCTTGAGGAGGCAGG + Intronic
932743853 2:74314800-74314822 CAGTGTCTCCTTGAGGCTGGTGG - Intronic
932788476 2:74630486-74630508 CTGGGGCCCGTTGAGGAGGCGGG - Intronic
933124514 2:78587540-78587562 CAGCCTCTCCTTTAGAAGGCTGG - Intergenic
933761613 2:85676112-85676134 CAGGCTCTACTTGAAGGGGCAGG - Intergenic
933768437 2:85727792-85727814 CAGGGTCTCGTGGAGAACGCCGG - Intergenic
934663976 2:96157634-96157656 CAAGGGCTCCTTGGGGAGGTAGG - Intergenic
935130750 2:100259136-100259158 AAGGGTCACCTTAAGGAAGCTGG + Intergenic
935334322 2:102001059-102001081 CAGGGTCTAATGCAGGAGGCAGG + Intronic
935706273 2:105860352-105860374 TAGGGTCCCCTTGTGGATGCAGG - Intronic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
935771939 2:106432752-106432774 CAGGGTCTTGTTGTGCAGGCTGG - Intronic
935908130 2:107863189-107863211 CAGGGTCTTGTTGTGCAGGCTGG + Intronic
936061743 2:109299206-109299228 CAGGCAGTCCTTGGGGAGGCAGG - Intronic
936258687 2:110938266-110938288 CTGGGTCTCAGTGAGGATGCAGG + Intronic
937153384 2:119701390-119701412 CAGGGCCTCAGTTAGGAGGCAGG - Intergenic
937157308 2:119730200-119730222 GAGGGTTTCCTTGAAGAGGGTGG - Intergenic
937877783 2:126838214-126838236 CAGGGTGTGGATGAGGAGGCAGG - Intergenic
938730453 2:134143034-134143056 CAGGCCCTCCTCAAGGAGGCTGG + Intronic
938731957 2:134153559-134153581 GATGGTCTCCCTGAAGAGGCTGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946135067 2:217639226-217639248 CAGGGCCTACTTGAGGGTGCAGG + Intronic
948513320 2:238487691-238487713 CAGGGCCTCCGGGAGGAAGCAGG + Intergenic
948737422 2:240017998-240018020 CAGGCTGACCTTGAGGAGTCAGG - Intronic
948771348 2:240252748-240252770 CACGGTCTCCATGAGAAAGCTGG + Intergenic
948912391 2:241011083-241011105 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912401 2:241011110-241011132 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912413 2:241011146-241011168 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912426 2:241011182-241011204 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912448 2:241011245-241011267 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
1169807824 20:9577504-9577526 CAGAGACTCCTAAAGGAGGCTGG - Intronic
1170125869 20:12963531-12963553 GAGGGTCTCTTTGATGAGGAGGG - Intergenic
1170665392 20:18381836-18381858 CAGGGTCTCCCTATGTAGGCTGG - Intergenic
1170898147 20:20435151-20435173 CAGGGCCTCCTTGAGGAAAAGGG - Intronic
1171342878 20:24444461-24444483 CAGTTTCTTCTTGAGGAGCCTGG - Intergenic
1172024294 20:31937464-31937486 CAGGGTGTCTTCCAGGAGGCAGG - Exonic
1172900680 20:38332314-38332336 CAAGGGGTCATTGAGGAGGCTGG + Intronic
1173047073 20:39522727-39522749 CTTGGTCTAGTTGAGGAGGCAGG + Intergenic
1174936126 20:54871021-54871043 CAGGGTCTACTTGAGTGGGGAGG + Intergenic
1175085268 20:56453012-56453034 CAGTTTCTCTTTGGGGAGGCTGG - Exonic
1175468732 20:59210580-59210602 CAGGGTCACCATGAGCATGCAGG - Intronic
1175902165 20:62364259-62364281 CAGGGGCTCCTGGAGAAGGTAGG + Intronic
1175917822 20:62435222-62435244 CAGGGTCTCCTTTTGGGGGCAGG - Intergenic
1175948833 20:62571750-62571772 CAGGGTCTCATTGAGGTGCCAGG - Intergenic
1176083729 20:63286503-63286525 CAGGCTCTCCAGGAGGTGGCTGG + Intronic
1177805270 21:25869055-25869077 CAGAGTCTCCTTGCCCAGGCTGG + Intergenic
1177850442 21:26340738-26340760 CAGGGCCTACTTGAGCAGGGAGG - Intergenic
1178431267 21:32520588-32520610 CAGGGACTCATGGAGAAGGCTGG - Intergenic
1178949417 21:36974133-36974155 CAGGGTCCCCTGGTGGAAGCTGG + Intronic
1179475689 21:41642057-41642079 CAGGGCCTCCGTCAGAAGGCTGG + Intergenic
1179896433 21:44366115-44366137 GAGGGTCTCCTGGAGGACGGGGG + Intronic
1180534778 22:16387632-16387654 CAGAGTGTCCTGGGGGAGGCAGG + Intergenic
1180710719 22:17837621-17837643 CAGGGTCTCCTCCAGGAGACAGG + Intronic
1180801755 22:18635088-18635110 CAAGGTCTCAGTGACGAGGCAGG + Intergenic
1180852999 22:19030629-19030651 CAAGGTCTCAGTGAGGAGGCAGG + Intergenic
1180927934 22:19568998-19569020 CAGGGTCACCTTGTGCTGGCTGG + Intergenic
1181219967 22:21360173-21360195 CAAGGTCTCAGTGACGAGGCAGG - Intergenic
1181403729 22:22667358-22667380 GAGTGTCTCCTTAAGGATGCTGG - Intergenic
1181408738 22:22703343-22703365 CAGCATCTCCTGAAGGAGGCTGG - Intergenic
1181414022 22:22746469-22746491 GAGTGTCTCCTGAAGGAGGCTGG - Intronic
1181478319 22:23181718-23181740 CAGGTTGTCCTTCAGGAAGCGGG - Exonic
1181500509 22:23313223-23313245 CTTGGTCTCCTTGAGGAGTAGGG - Intronic
1181514038 22:23401551-23401573 CAGGGTGTCCTGGAAGGGGCTGG - Intergenic
1181705730 22:24648534-24648556 CTTGGTCTCCTTGAGGAGTAGGG - Intergenic
1181861955 22:25826007-25826029 CTGTGTCTCCTTCATGAGGCTGG - Intronic
1181985840 22:26799351-26799373 GGGGGTCCTCTTGAGGAGGCTGG - Intergenic
1182357491 22:29728885-29728907 CATGGGCTCCCTGGGGAGGCCGG + Intronic
1183117955 22:35706388-35706410 CAAAGTCTCCTTGAAGAGGCTGG - Intergenic
1183508388 22:38221661-38221683 CATGGTCTCCTTGAGGCTGCTGG + Exonic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
1184681739 22:46075919-46075941 CAGGGTCTCCTTGGGGACCCGGG + Intronic
1184744156 22:46446352-46446374 CAGGGTCACCCTAAGCAGGCAGG - Intronic
1184764274 22:46563590-46563612 CAGGGTCTCCCTGGGGCAGCAGG + Intergenic
1184801515 22:46763121-46763143 CCTGGGCTCCTTGGGGAGGCTGG + Intronic
1185147669 22:49148057-49148079 CAGGGTCTCTGTGAGGAGATGGG + Intergenic
950828093 3:15846728-15846750 CTGGGTGTGCCTGAGGAGGCTGG + Intronic
952898690 3:38095821-38095843 CAGGTTGTCCTGGAGAAGGCTGG - Intronic
953414413 3:42707442-42707464 CAGGGGCTCCCTGAGGAGTGGGG + Intronic
953910594 3:46890921-46890943 CAGAATCTCCTTGAAGAGGAGGG + Intronic
953981168 3:47413828-47413850 CAGGGCCTCCTTGCCCAGGCAGG - Exonic
954133012 3:48569639-48569661 CTGAGTCTCCCTGAGGGGGCAGG + Exonic
954377286 3:50201895-50201917 CAGGGGCACCTTGAGGTTGCAGG - Intergenic
954950420 3:54468118-54468140 CAGGTTCTCTTGGAGGTGGCTGG + Intronic
955916423 3:63912422-63912444 GGGGGTGGCCTTGAGGAGGCGGG + Intronic
956846088 3:73184131-73184153 CAGGGACTACTTGAGGTGGAGGG - Intergenic
960159166 3:114331240-114331262 CCAGGTCTCCTGGAGGTGGCAGG - Intergenic
961324587 3:126102760-126102782 CAGGGAATCCCTGAGGAGACGGG + Intergenic
961393547 3:126570633-126570655 CAGGGCCTCCTGGAAGGGGCTGG + Intergenic
961588892 3:127960073-127960095 CAGGGTCACCTCAAGGTGGCAGG - Intronic
963008049 3:140744554-140744576 CAGGGGCTCCTTGGGGAGATGGG - Intergenic
963028484 3:140942522-140942544 CAGGGCCGCTTTGAGGAGCCTGG + Intronic
964183963 3:153920186-153920208 AATGTCCTCCTTGAGGAGGCAGG + Intergenic
964419539 3:156486688-156486710 CAGGGCCTCCTGGAGGATGAAGG + Intronic
965065823 3:163847354-163847376 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
966219625 3:177537796-177537818 CAGTGTCACTTTGAGGAGGGTGG + Intergenic
967483148 3:189998452-189998474 AAGGGTCTCTTAGAGAAGGCAGG - Intronic
968520483 4:1032742-1032764 CAGGGGCTCCTGGAGGACCCGGG - Intergenic
968872128 4:3247475-3247497 CAGGGCTTCCTAGAGGAGGTAGG + Exonic
969022144 4:4145850-4145872 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
969499972 4:7546662-7546684 CAGCGTCCCCATGAGGAGGCAGG - Intronic
969652583 4:8476659-8476681 GAGGGTCTCATGGAGGAGGGAGG - Intronic
969731723 4:8961542-8961564 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
969791316 4:9495649-9495671 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
971535710 4:27748018-27748040 CAGTATCTCCTTGGTGAGGCAGG - Intergenic
972143379 4:35989669-35989691 CAGGGTCTACTTGAGGGTGAAGG + Intronic
974149033 4:57981835-57981857 CAGGGTCTCACTGAGCAGACTGG + Intergenic
974683175 4:65191345-65191367 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
977147872 4:93468603-93468625 AAGGTTCTGCTTGAAGAGGCCGG + Intronic
978390136 4:108216555-108216577 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
978651828 4:111014841-111014863 CAGGGGCTCCCTGAGGAACCTGG - Intergenic
981096545 4:140788157-140788179 CAGGACCCACTTGAGGAGGCAGG + Intergenic
983853081 4:172607297-172607319 CAGGGTCTACTTGAGGGTGGAGG - Intronic
984023573 4:174516472-174516494 CAAGGTCTACTTGAGGATGAAGG + Intronic
984056322 4:174933631-174933653 TGGGGTCTCCTTGAGGATGGAGG - Intronic
985063062 4:186097107-186097129 CAGGGGCTCCCTAAGGAGGGAGG - Intergenic
985445290 4:190018296-190018318 CAGGGCCCCTTTGAGCAGGCCGG - Intergenic
985716646 5:1466822-1466844 CAGGGCCGTCTTGAGGATGCAGG + Exonic
985829378 5:2216767-2216789 CAGTGTTTCCATGAGCAGGCAGG + Intergenic
985844364 5:2333362-2333384 CAGGGTCTCCTTTAGGGGAGGGG + Intergenic
986522925 5:8641222-8641244 CAGGGACTACTAGAGGAGGGAGG + Intergenic
988043788 5:25921505-25921527 TAGGGTCTCCTTGAGGGTGGAGG + Intergenic
988536932 5:32077544-32077566 CAGGTTCTCTGTGAGGTGGCTGG - Exonic
988560151 5:32273647-32273669 CAGGGTCTCCTTTCCGTGGCAGG - Intronic
988685751 5:33523612-33523634 AAGGTACCCCTTGAGGAGGCTGG + Exonic
989153243 5:38320542-38320564 CAGTTTCTCCTTGAGGTGGGAGG + Intronic
989461345 5:41702640-41702662 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
991430607 5:66541023-66541045 CAGAGGCTCCTTGAAGAGCCTGG - Intergenic
993390968 5:87319359-87319381 GAGGGTCTCCATGAGGACTCTGG + Intronic
993558045 5:89366634-89366656 CAGAGTCTCCCTGGGGTGGCTGG - Intergenic
993568703 5:89508709-89508731 TAGGGTCTACTTGAGGTGGGAGG + Intergenic
995876445 5:116795174-116795196 CAGGGTCTCCCTGGGTAGGCTGG - Intergenic
995919182 5:117290346-117290368 AACGGTCTCCTTGAGAAGACAGG - Intergenic
996469403 5:123842727-123842749 CAGGGCCTACTTGAGGATGGAGG + Intergenic
996644724 5:125799737-125799759 CAGGGTCTCCATGAGGTAGTTGG - Intergenic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
1002059191 5:176616494-176616516 CATGGTGCCCTTGAGGAGCCAGG + Intergenic
1002086798 5:176780978-176781000 CAGTGTCTCCATGAGCAGGAAGG + Intergenic
1002405683 5:179028201-179028223 AAGGGTCTCCTTGATGTGCCAGG + Intronic
1003065536 6:2901667-2901689 CAGGCTCACCTGGAGGAGTCAGG - Intronic
1003086649 6:3065578-3065600 CAGGCTCACCTGGAGGAGTCAGG + Intronic
1004829071 6:19457923-19457945 CAGTGTCTCTTTGAGGAGCTGGG - Intergenic
1005726611 6:28655378-28655400 CTGAGTCTCCTGCAGGAGGCTGG + Intergenic
1006250071 6:32776069-32776091 TAGGGTCTCCCTGACGAAGCTGG + Intergenic
1006459248 6:34148784-34148806 CAAGGTCTCCCTAAGGATGCTGG + Intronic
1010096809 6:72056249-72056271 CAGGGCCTACTTGAGGATGGAGG + Intronic
1010524752 6:76887047-76887069 CATGGGTTCCTTCAGGAGGCTGG - Intergenic
1011371367 6:86640404-86640426 CATGATATCCTTGAGGAGGAAGG - Intergenic
1013421735 6:109973142-109973164 TAGGGTCTATTTGAGGATGCAGG + Intergenic
1014194075 6:118532342-118532364 CAGGGCCTACTTGATGAGGGGGG + Intronic
1014466675 6:121764407-121764429 CAGGGCCTACTTGAGGAAGGAGG + Intergenic
1015402125 6:132798636-132798658 CTGGGTCCCCGGGAGGAGGCCGG + Intergenic
1018810062 6:167292843-167292865 CAGGGTCTCCTTCTGCAGGCAGG - Intronic
1018945282 6:168343597-168343619 GAGGCTCTCCTTGTGGTGGCCGG - Intergenic
1019290156 7:246284-246306 CAGGGTGGCCCTGAGGAGGCTGG + Intronic
1019550522 7:1599965-1599987 CAGGGCCTCCCTGGTGAGGCGGG + Intergenic
1020309568 7:6857892-6857914 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
1022785585 7:33634164-33634186 CAGGCACTCCTGGGGGAGGCAGG - Intergenic
1022795432 7:33727897-33727919 CAGGCTCTCCTTGTGGGGGTGGG + Exonic
1023674123 7:42612630-42612652 CAGGGTCTCATCCAGGAGGGGGG + Intergenic
1024671592 7:51600477-51600499 CTGGGTGTCCCTGGGGAGGCTGG + Intergenic
1026604385 7:71803445-71803467 CAGGGTTTCCTGGAGCAGTCAGG + Intronic
1027151008 7:75733636-75733658 CAAGGCTTCCTGGAGGAGGCTGG + Intronic
1028732396 7:94166361-94166383 TAGGGTCTCCCTGACTAGGCTGG + Intergenic
1029957907 7:104659122-104659144 CAGGGTCTCATTTAGCAGGGAGG - Intronic
1031167356 7:118245292-118245314 CATGCTCTCCTTGGGGAGGATGG - Intergenic
1031258221 7:119483391-119483413 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
1031268634 7:119615567-119615589 TGGGGTCTCCTTGAGGAAGGAGG - Intergenic
1031546993 7:123063135-123063157 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
1033313230 7:140277605-140277627 CTGGGTCTACTTGAGGTTGCAGG + Intergenic
1034275888 7:149823721-149823743 CAGGGGCTGCTGGAGCAGGCTGG + Intergenic
1034999847 7:155603996-155604018 CAGGGTGACCTTGAGTGGGCGGG - Intergenic
1035037580 7:155905410-155905432 CAGGGGCTCCTGGAGGAGTGTGG - Intergenic
1035286516 7:157810492-157810514 CAGGGTCTCCATGGGGACGGCGG + Intronic
1035297903 7:157877291-157877313 CAGGGTTTCCTTGGGGACCCCGG + Intronic
1036743401 8:11387556-11387578 CCTGGCTTCCTTGAGGAGGCTGG - Intergenic
1037313082 8:17576830-17576852 CAGGTTCTGCCTGAGGAGGTGGG + Intronic
1037736816 8:21573871-21573893 CAGGGACTCCTTTTGGGGGCCGG - Intergenic
1039804179 8:40984684-40984706 CAGAGCTTCCTTCAGGAGGCTGG + Intergenic
1039840335 8:41288505-41288527 CAGGGTCTCTTTGCCCAGGCTGG - Intronic
1041018797 8:53617549-53617571 TAGGGTCTCCCTGACCAGGCTGG + Intergenic
1042621555 8:70711613-70711635 CAGGGCTTACTTGAGGATGCAGG + Intronic
1042621586 8:70711817-70711839 CAGGGCTTACTTGAGGATGCAGG + Intronic
1043720630 8:83544178-83544200 GGGGGACTCCTTCAGGAGGCCGG + Intergenic
1046882709 8:119327748-119327770 CAGGTTATCCTACAGGAGGCAGG + Intergenic
1047641937 8:126829954-126829976 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1048509967 8:135053484-135053506 TAGGGTCTTCATAAGGAGGCAGG + Intergenic
1048550879 8:135432823-135432845 CAGGGTATCCTGGATGAGGCAGG + Intergenic
1049219623 8:141422949-141422971 CATGGCCTCCTGGAGGAGCCTGG + Intronic
1049559914 8:143304805-143304827 AGGGCTCTCCTTGGGGAGGCAGG - Intronic
1049849219 8:144821795-144821817 GAGGGTGTCCTAGAGGAGGGAGG - Intergenic
1050719606 9:8571267-8571289 TAGGGTCTCCCTTAAGAGGCAGG + Intronic
1051366191 9:16323144-16323166 TAGGGTCTCCTTGAGGACCTTGG + Intergenic
1052703662 9:31968193-31968215 TAGGGTCTACTTGAGGTGGTAGG + Intergenic
1053798685 9:41749264-41749286 CAGGGTCTGCTTGAGTGGGGAGG + Intergenic
1054146517 9:61565697-61565719 CAGGGTCTGCTTGAGTGGGGAGG - Intergenic
1054187100 9:61961309-61961331 CAGGGTCTGCTTGAGTGGGGAGG + Intergenic
1054466254 9:65496765-65496787 CAGGGTCTGCTTGAGTGGGGAGG - Intergenic
1054651408 9:67627213-67627235 CAGGGTCTGCTTGAGTGGGGAGG - Intergenic
1054706519 9:68468184-68468206 CCGGGTCTTCTTGAGGAGTAGGG - Intronic
1055702131 9:78956489-78956511 CAGGGTCTTCTTGTGGTGACAGG + Intergenic
1056127396 9:83549107-83549129 TGGGGTCTTCTTGAGGGGGCAGG - Intergenic
1056763695 9:89431866-89431888 GAACGTGTCCTTGAGGAGGCGGG - Intronic
1057179581 9:93022487-93022509 CAGGGCCTCCTGGAGGCGGAGGG + Intronic
1057843994 9:98507837-98507859 CAGGGGCTGCCTGAGGAAGCAGG + Intronic
1059235591 9:112758217-112758239 CAGGGTCTCCAAGAGGATGGGGG - Intronic
1059434075 9:114266031-114266053 CAGGAACCCCATGAGGAGGCTGG + Intronic
1059773636 9:117452498-117452520 CAGGGTCTCCTTTCCCAGGCTGG + Intergenic
1059787134 9:117598147-117598169 CAGCTTCTGCCTGAGGAGGCAGG - Intergenic
1060661896 9:125409354-125409376 CAGGGGCTCCCTGGGGTGGCTGG - Intergenic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1061502573 9:131012510-131012532 CAGGATGTCTTTGAGGAGGCAGG - Intronic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062028892 9:134353078-134353100 CAGGGTCCCCTTCTGGAGGGGGG + Intronic
1185921675 X:4100013-4100035 CAGGGCCTACTTGAGGATGAAGG - Intergenic
1186052091 X:5607581-5607603 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1187600285 X:20821732-20821754 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
1187636538 X:21235462-21235484 CAGGGCCTACTTGAGGGGGTAGG + Intergenic
1188298125 X:28475062-28475084 CAGGGCCTACTTGAGGATGAAGG + Intergenic
1188738658 X:33749960-33749982 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1189052858 X:37664720-37664742 CAGGGCCTACTTGAGGAGGGAGG - Intronic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190735869 X:53255874-53255896 CAGTGTCGCCCTGAGGAAGCAGG - Exonic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1191255043 X:58276079-58276101 CAGGGAGTGGTTGAGGAGGCCGG - Intergenic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1194077586 X:89415919-89415941 TGGGGTCTACTTGAGGAGGTAGG + Intergenic
1194545910 X:95233169-95233191 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
1195534759 X:105998752-105998774 CAGGGCCTACTTGAGGTTGCAGG + Intergenic
1197621326 X:128752976-128752998 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1198195313 X:134354792-134354814 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1198302082 X:135343213-135343235 CTGGGCCTCCTTGAGGAAGATGG + Exonic
1198837722 X:140821837-140821859 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1199550929 X:149060567-149060589 TAGTGTCTCCTTCAGGAAGCTGG + Intergenic
1199850567 X:151722677-151722699 CAGGGTCTCCCTGTGGCGCCAGG - Exonic
1200058159 X:153472321-153472343 CAGGTTCTCCATGAGGGGGATGG - Intronic
1200430235 Y:3071463-3071485 TGGGGTCTACTTGAGGAGGTAGG + Intergenic
1200483471 Y:3737104-3737126 CGGGGTCTACTTGAGGGGGCAGG + Intergenic
1201540901 Y:15103579-15103601 AAGGGACTCCTTTAGGAGACTGG - Intergenic