ID: 1134813213 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:17184986-17185008 |
Sequence | AGGACCTTCTGGGAAGGATG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134813213_1134813222 | 16 | Left | 1134813213 | 16:17184986-17185008 | CCACATCCTTCCCAGAAGGTCCT | No data | ||
Right | 1134813222 | 16:17185025-17185047 | CTTGGCTTTCTGCAGAACCTTGG | No data | ||||
1134813213_1134813218 | -2 | Left | 1134813213 | 16:17184986-17185008 | CCACATCCTTCCCAGAAGGTCCT | No data | ||
Right | 1134813218 | 16:17185007-17185029 | CTAAGCCCATAGACCACTCTTGG | 0: 1 1: 0 2: 0 3: 6 4: 74 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134813213 | Original CRISPR | AGGACCTTCTGGGAAGGATG TGG (reversed) | Intronic | ||