ID: 1134813213

View in Genome Browser
Species Human (GRCh38)
Location 16:17184986-17185008
Sequence AGGACCTTCTGGGAAGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134813213_1134813222 16 Left 1134813213 16:17184986-17185008 CCACATCCTTCCCAGAAGGTCCT No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813213_1134813218 -2 Left 1134813213 16:17184986-17185008 CCACATCCTTCCCAGAAGGTCCT No data
Right 1134813218 16:17185007-17185029 CTAAGCCCATAGACCACTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134813213 Original CRISPR AGGACCTTCTGGGAAGGATG TGG (reversed) Intronic