ID: 1134813215

View in Genome Browser
Species Human (GRCh38)
Location 16:17184996-17185018
Sequence CTATGGGCTTAGGACCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134813215_1134813222 6 Left 1134813215 16:17184996-17185018 CCCAGAAGGTCCTAAGCCCATAG No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134813215 Original CRISPR CTATGGGCTTAGGACCTTCT GGG (reversed) Intronic