ID: 1134813216

View in Genome Browser
Species Human (GRCh38)
Location 16:17184997-17185019
Sequence TCTATGGGCTTAGGACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134813216_1134813222 5 Left 1134813216 16:17184997-17185019 CCAGAAGGTCCTAAGCCCATAGA No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134813216 Original CRISPR TCTATGGGCTTAGGACCTTC TGG (reversed) Intronic