ID: 1134813217

View in Genome Browser
Species Human (GRCh38)
Location 16:17185006-17185028
Sequence CAAGAGTGGTCTATGGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134813217_1134813222 -4 Left 1134813217 16:17185006-17185028 CCTAAGCCCATAGACCACTCTTG No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813217_1134813224 24 Left 1134813217 16:17185006-17185028 CCTAAGCCCATAGACCACTCTTG No data
Right 1134813224 16:17185053-17185075 ATGAGATCTCCGAGAACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134813217 Original CRISPR CAAGAGTGGTCTATGGGCTT AGG (reversed) Intronic