ID: 1134813218 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:17185007-17185029 |
Sequence | CTAAGCCCATAGACCACTCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 81 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 74} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134813213_1134813218 | -2 | Left | 1134813213 | 16:17184986-17185008 | CCACATCCTTCCCAGAAGGTCCT | No data | ||
Right | 1134813218 | 16:17185007-17185029 | CTAAGCCCATAGACCACTCTTGG | 0: 1 1: 0 2: 0 3: 6 4: 74 |
||||
1134813214_1134813218 | -8 | Left | 1134813214 | 16:17184992-17185014 | CCTTCCCAGAAGGTCCTAAGCCC | No data | ||
Right | 1134813218 | 16:17185007-17185029 | CTAAGCCCATAGACCACTCTTGG | 0: 1 1: 0 2: 0 3: 6 4: 74 |
||||
1134813212_1134813218 | 1 | Left | 1134813212 | 16:17184983-17185005 | CCACCACATCCTTCCCAGAAGGT | No data | ||
Right | 1134813218 | 16:17185007-17185029 | CTAAGCCCATAGACCACTCTTGG | 0: 1 1: 0 2: 0 3: 6 4: 74 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134813218 | Original CRISPR | CTAAGCCCATAGACCACTCT TGG | Intronic | ||