ID: 1134813218

View in Genome Browser
Species Human (GRCh38)
Location 16:17185007-17185029
Sequence CTAAGCCCATAGACCACTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134813213_1134813218 -2 Left 1134813213 16:17184986-17185008 CCACATCCTTCCCAGAAGGTCCT No data
Right 1134813218 16:17185007-17185029 CTAAGCCCATAGACCACTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1134813214_1134813218 -8 Left 1134813214 16:17184992-17185014 CCTTCCCAGAAGGTCCTAAGCCC No data
Right 1134813218 16:17185007-17185029 CTAAGCCCATAGACCACTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1134813212_1134813218 1 Left 1134813212 16:17184983-17185005 CCACCACATCCTTCCCAGAAGGT No data
Right 1134813218 16:17185007-17185029 CTAAGCCCATAGACCACTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134813218 Original CRISPR CTAAGCCCATAGACCACTCT TGG Intronic