ID: 1134813222

View in Genome Browser
Species Human (GRCh38)
Location 16:17185025-17185047
Sequence CTTGGCTTTCTGCAGAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134813213_1134813222 16 Left 1134813213 16:17184986-17185008 CCACATCCTTCCCAGAAGGTCCT No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813216_1134813222 5 Left 1134813216 16:17184997-17185019 CCAGAAGGTCCTAAGCCCATAGA No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813219_1134813222 -10 Left 1134813219 16:17185012-17185034 CCCATAGACCACTCTTGGCTTTC No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813217_1134813222 -4 Left 1134813217 16:17185006-17185028 CCTAAGCCCATAGACCACTCTTG No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813215_1134813222 6 Left 1134813215 16:17184996-17185018 CCCAGAAGGTCCTAAGCCCATAG No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813212_1134813222 19 Left 1134813212 16:17184983-17185005 CCACCACATCCTTCCCAGAAGGT No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data
1134813214_1134813222 10 Left 1134813214 16:17184992-17185014 CCTTCCCAGAAGGTCCTAAGCCC No data
Right 1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134813222 Original CRISPR CTTGGCTTTCTGCAGAACCT TGG Intronic
No off target data available for this crispr