ID: 1134813224

View in Genome Browser
Species Human (GRCh38)
Location 16:17185053-17185075
Sequence ATGAGATCTCCGAGAACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134813219_1134813224 18 Left 1134813219 16:17185012-17185034 CCCATAGACCACTCTTGGCTTTC No data
Right 1134813224 16:17185053-17185075 ATGAGATCTCCGAGAACTCTAGG No data
1134813220_1134813224 17 Left 1134813220 16:17185013-17185035 CCATAGACCACTCTTGGCTTTCT No data
Right 1134813224 16:17185053-17185075 ATGAGATCTCCGAGAACTCTAGG No data
1134813217_1134813224 24 Left 1134813217 16:17185006-17185028 CCTAAGCCCATAGACCACTCTTG No data
Right 1134813224 16:17185053-17185075 ATGAGATCTCCGAGAACTCTAGG No data
1134813221_1134813224 10 Left 1134813221 16:17185020-17185042 CCACTCTTGGCTTTCTGCAGAAC No data
Right 1134813224 16:17185053-17185075 ATGAGATCTCCGAGAACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134813224 Original CRISPR ATGAGATCTCCGAGAACTCT AGG Intronic