ID: 1134815990

View in Genome Browser
Species Human (GRCh38)
Location 16:17206384-17206406
Sequence GCTCTCGATGGGTTTAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134815984_1134815990 -7 Left 1134815984 16:17206368-17206390 CCAGAAAGAATCCCCTGCTCTCG No data
Right 1134815990 16:17206384-17206406 GCTCTCGATGGGTTTAGAAAAGG No data
1134815983_1134815990 -6 Left 1134815983 16:17206367-17206389 CCCAGAAAGAATCCCCTGCTCTC No data
Right 1134815990 16:17206384-17206406 GCTCTCGATGGGTTTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134815990 Original CRISPR GCTCTCGATGGGTTTAGAAA AGG Intronic
No off target data available for this crispr