ID: 1134818476

View in Genome Browser
Species Human (GRCh38)
Location 16:17226351-17226373
Sequence CTATAGCACTACTAGCACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134818468_1134818476 19 Left 1134818468 16:17226309-17226331 CCACCGTTACATTCAAAGCCTCA No data
Right 1134818476 16:17226351-17226373 CTATAGCACTACTAGCACTATGG No data
1134818470_1134818476 16 Left 1134818470 16:17226312-17226334 CCGTTACATTCAAAGCCTCAGGG No data
Right 1134818476 16:17226351-17226373 CTATAGCACTACTAGCACTATGG No data
1134818473_1134818476 -7 Left 1134818473 16:17226335-17226357 CCGTAGTACCCTTGTACTATAGC No data
Right 1134818476 16:17226351-17226373 CTATAGCACTACTAGCACTATGG No data
1134818472_1134818476 1 Left 1134818472 16:17226327-17226349 CCTCAGGGCCGTAGTACCCTTGT No data
Right 1134818476 16:17226351-17226373 CTATAGCACTACTAGCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134818476 Original CRISPR CTATAGCACTACTAGCACTA TGG Intronic
No off target data available for this crispr