ID: 1134818751

View in Genome Browser
Species Human (GRCh38)
Location 16:17228468-17228490
Sequence CACAGAACGGTGATGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134818741_1134818751 28 Left 1134818741 16:17228417-17228439 CCTTGTTTAATAAGGTGTCACCT No data
Right 1134818751 16:17228468-17228490 CACAGAACGGTGATGGGGTTGGG No data
1134818743_1134818751 8 Left 1134818743 16:17228437-17228459 CCTAAACACTGAGTGGTGCATAC No data
Right 1134818751 16:17228468-17228490 CACAGAACGGTGATGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134818751 Original CRISPR CACAGAACGGTGATGGGGTT GGG Intronic
No off target data available for this crispr