ID: 1134818866

View in Genome Browser
Species Human (GRCh38)
Location 16:17229315-17229337
Sequence GGTCACATGCACAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134818866_1134818871 -3 Left 1134818866 16:17229315-17229337 CCATCCTCCTTGTGCATGTGACC No data
Right 1134818871 16:17229335-17229357 ACCCCAGCTGTGGGCTTATGTGG No data
1134818866_1134818875 2 Left 1134818866 16:17229315-17229337 CCATCCTCCTTGTGCATGTGACC No data
Right 1134818875 16:17229340-17229362 AGCTGTGGGCTTATGTGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134818866 Original CRISPR GGTCACATGCACAAGGAGGA TGG (reversed) Intronic
No off target data available for this crispr