ID: 1134825598

View in Genome Browser
Species Human (GRCh38)
Location 16:17281838-17281860
Sequence TGGACCTGGGTCAGTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134825592_1134825598 8 Left 1134825592 16:17281807-17281829 CCGTGGGCCACAAACACTTCTTG 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1134825598 16:17281838-17281860 TGGACCTGGGTCAGTCCCTCTGG No data
1134825594_1134825598 1 Left 1134825594 16:17281814-17281836 CCACAAACACTTCTTGGAAACAC No data
Right 1134825598 16:17281838-17281860 TGGACCTGGGTCAGTCCCTCTGG No data
1134825591_1134825598 11 Left 1134825591 16:17281804-17281826 CCACCGTGGGCCACAAACACTTC No data
Right 1134825598 16:17281838-17281860 TGGACCTGGGTCAGTCCCTCTGG No data
1134825588_1134825598 30 Left 1134825588 16:17281785-17281807 CCGCAAATCATCTTGGGTGCCAC No data
Right 1134825598 16:17281838-17281860 TGGACCTGGGTCAGTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134825598 Original CRISPR TGGACCTGGGTCAGTCCCTC TGG Intronic
No off target data available for this crispr