ID: 1134829532

View in Genome Browser
Species Human (GRCh38)
Location 16:17312033-17312055
Sequence AAACCCCCATTGATATGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134829532_1134829535 -7 Left 1134829532 16:17312033-17312055 CCAAACCATATCAATGGGGGTTT No data
Right 1134829535 16:17312049-17312071 GGGGTTTAAGCAGAGGTCTGAGG No data
1134829532_1134829539 22 Left 1134829532 16:17312033-17312055 CCAAACCATATCAATGGGGGTTT No data
Right 1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG No data
1134829532_1134829536 3 Left 1134829532 16:17312033-17312055 CCAAACCATATCAATGGGGGTTT No data
Right 1134829536 16:17312059-17312081 CAGAGGTCTGAGGCCCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134829532 Original CRISPR AAACCCCCATTGATATGGTT TGG (reversed) Intronic
No off target data available for this crispr