ID: 1134829533

View in Genome Browser
Species Human (GRCh38)
Location 16:17312038-17312060
Sequence TGCTTAAACCCCCATTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134829533_1134829542 30 Left 1134829533 16:17312038-17312060 CCATATCAATGGGGGTTTAAGCA No data
Right 1134829542 16:17312091-17312113 AGAGTCAAGGTGTGAGCTGGAGG No data
1134829533_1134829539 17 Left 1134829533 16:17312038-17312060 CCATATCAATGGGGGTTTAAGCA No data
Right 1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG No data
1134829533_1134829536 -2 Left 1134829533 16:17312038-17312060 CCATATCAATGGGGGTTTAAGCA No data
Right 1134829536 16:17312059-17312081 CAGAGGTCTGAGGCCCAGAAAGG No data
1134829533_1134829541 27 Left 1134829533 16:17312038-17312060 CCATATCAATGGGGGTTTAAGCA No data
Right 1134829541 16:17312088-17312110 AGAAGAGTCAAGGTGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134829533 Original CRISPR TGCTTAAACCCCCATTGATA TGG (reversed) Intronic
No off target data available for this crispr