ID: 1134829539

View in Genome Browser
Species Human (GRCh38)
Location 16:17312078-17312100
Sequence AAGGCCTTCTAGAAGAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134829533_1134829539 17 Left 1134829533 16:17312038-17312060 CCATATCAATGGGGGTTTAAGCA No data
Right 1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG No data
1134829532_1134829539 22 Left 1134829532 16:17312033-17312055 CCAAACCATATCAATGGGGGTTT No data
Right 1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134829539 Original CRISPR AAGGCCTTCTAGAAGAGTCA AGG Intronic
No off target data available for this crispr