ID: 1134832099

View in Genome Browser
Species Human (GRCh38)
Location 16:17331987-17332009
Sequence GTTTAAATAATCCCAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134832099_1134832102 1 Left 1134832099 16:17331987-17332009 CCAGCCTCTGGGATTATTTAAAC No data
Right 1134832102 16:17332011-17332033 AGACAATCATATCCCCTTGTGGG No data
1134832099_1134832104 9 Left 1134832099 16:17331987-17332009 CCAGCCTCTGGGATTATTTAAAC No data
Right 1134832104 16:17332019-17332041 ATATCCCCTTGTGGGACACAGGG No data
1134832099_1134832103 8 Left 1134832099 16:17331987-17332009 CCAGCCTCTGGGATTATTTAAAC No data
Right 1134832103 16:17332018-17332040 CATATCCCCTTGTGGGACACAGG No data
1134832099_1134832101 0 Left 1134832099 16:17331987-17332009 CCAGCCTCTGGGATTATTTAAAC No data
Right 1134832101 16:17332010-17332032 AAGACAATCATATCCCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134832099 Original CRISPR GTTTAAATAATCCCAGAGGC TGG (reversed) Intronic