ID: 1134842723

View in Genome Browser
Species Human (GRCh38)
Location 16:17414596-17414618
Sequence GGCTTCCTGTGGGTGCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134842723_1134842730 23 Left 1134842723 16:17414596-17414618 CCACTGGGCACCCACAGGAAGCC 0: 1
1: 0
2: 1
3: 32
4: 305
Right 1134842730 16:17414642-17414664 GCAAAAGGGCATTTCTGCAAAGG 0: 1
1: 0
2: 0
3: 25
4: 195
1134842723_1134842729 9 Left 1134842723 16:17414596-17414618 CCACTGGGCACCCACAGGAAGCC 0: 1
1: 0
2: 1
3: 32
4: 305
Right 1134842729 16:17414628-17414650 ATAATGAGAAATGAGCAAAAGGG 0: 1
1: 0
2: 8
3: 105
4: 975
1134842723_1134842731 24 Left 1134842723 16:17414596-17414618 CCACTGGGCACCCACAGGAAGCC 0: 1
1: 0
2: 1
3: 32
4: 305
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data
1134842723_1134842728 8 Left 1134842723 16:17414596-17414618 CCACTGGGCACCCACAGGAAGCC 0: 1
1: 0
2: 1
3: 32
4: 305
Right 1134842728 16:17414627-17414649 CATAATGAGAAATGAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134842723 Original CRISPR GGCTTCCTGTGGGTGCCCAG TGG (reversed) Intronic
900105773 1:980454-980476 GGCGAGCTGTGGGTGCCAAGGGG - Exonic
900148253 1:1167558-1167580 GGCTTCCTCTGGGTTCCACGTGG - Intergenic
900313967 1:2048045-2048067 GAAGTCCTGTGGGTGCCCAGTGG + Intergenic
900541507 1:3205234-3205256 GGGTTCCGGTGGGTGCCCTGTGG - Intronic
901050395 1:6423346-6423368 GCCCTCCTCTGGGTGCCCAGAGG - Intronic
901081445 1:6586341-6586363 GGGTTGCTGGGGGTGGCCAGGGG - Intronic
901490195 1:9592787-9592809 GGCTTCCTCAGGCTTCCCAGGGG + Intronic
902126215 1:14213799-14213821 GGCTACCTGTGGTGGCCCAGAGG + Intergenic
902640309 1:17762656-17762678 GGCTGCAGGTGGGAGCCCAGGGG + Intronic
902962655 1:19975894-19975916 GGCTTCTTGTGGGAACCCTGGGG + Intronic
903466251 1:23554520-23554542 GGCTTCCCGGAGGAGCCCAGCGG + Intergenic
904452222 1:30621162-30621184 GGATTGCTGTGGGAGCTCAGGGG - Intergenic
905900989 1:41581868-41581890 GTCAACATGTGGGTGCCCAGGGG + Exonic
906197022 1:43935899-43935921 TGCTGCCTCTGGGAGCCCAGGGG - Intronic
907073978 1:51562629-51562651 GGCTTCCTCTGGGTAGCAAGGGG - Intergenic
907924670 1:58944329-58944351 GCTTTCCCGTTGGTGCCCAGTGG - Intergenic
910436465 1:87210721-87210743 TGCTTCCTTTTCGTGCCCAGGGG + Intergenic
913217697 1:116634418-116634440 GGCTTGCTGTGGGTGCTCCAAGG - Intronic
919425199 1:197421302-197421324 GGCTTCCTGTGGGTCAAAAGTGG + Exonic
922695716 1:227729907-227729929 GCCTTCCTATGGGGGCCCACAGG + Intronic
922878973 1:228964821-228964843 GACTTCCTGGGGGTTCGCAGTGG - Intergenic
923667511 1:236011920-236011942 GGCTTCCGTTGCGTGCCCGGAGG - Exonic
923744516 1:236687416-236687438 GGCGTTCTCTGGGGGCCCAGTGG + Intronic
924620543 1:245656590-245656612 AGCCCCCTGTGGGTGCCCAAGGG - Intronic
1063127265 10:3146541-3146563 GGCGGTCTGTGGGTGGCCAGAGG - Intronic
1063236444 10:4121594-4121616 GTCTTCCAGGGGGTGCCCACGGG + Intergenic
1063596317 10:7439189-7439211 GGGCTCCTGTGTTTGCCCAGTGG - Intergenic
1063773117 10:9227094-9227116 GGCTTCTTGTGAATGCCCAAGGG - Intergenic
1064097715 10:12436214-12436236 GGCTTCACATGTGTGCCCAGGGG + Intronic
1066300886 10:34094509-34094531 GGCTTCCTCTGGGTCTCTAGGGG - Intergenic
1066624776 10:37395300-37395322 GGCTTCATGAGTGTGCACAGGGG + Intergenic
1067249948 10:44577723-44577745 GGATGCCTGTGGGTCTCCAGAGG - Intergenic
1067296748 10:44979056-44979078 GGCTACCTGTGAGGGCCCAGTGG - Intronic
1069754226 10:70763542-70763564 CACTTCCTGTAGGAGCCCAGTGG + Intergenic
1070370028 10:75773434-75773456 GGGTTCCTGTGTGGGTCCAGTGG + Intronic
1070667921 10:78358561-78358583 GCCTTGCTGCGGGTGCCCAGGGG - Intergenic
1073035460 10:100561907-100561929 CACTTCCTATGGCTGCCCAGAGG + Intergenic
1073660086 10:105465349-105465371 GGATGCCTGTGGGAGCCCTGTGG - Intergenic
1074088297 10:110225627-110225649 GACTCCCTGCGGTTGCCCAGGGG - Intronic
1074311559 10:112327309-112327331 AGGTTGCTGTGGGAGCCCAGGGG + Intergenic
1074483822 10:113854157-113854179 GGCTCCCTTGGGGTGCCGAGTGG - Intronic
1074772114 10:116741546-116741568 GTCTTCCTGTGGGTCCCAAGTGG - Intronic
1074873661 10:117597284-117597306 GGGTTCCTGTGGATGCACAGAGG - Intergenic
1075731656 10:124640056-124640078 GGCTTGCTGGGGGTTCCTAGGGG - Intronic
1076061761 10:127418742-127418764 GGCTGTCTGGGGATGCCCAGGGG - Intronic
1076457105 10:130608138-130608160 GGCTCCATGTGGGTTCTCAGTGG - Intergenic
1076885705 10:133261522-133261544 CGCTCCCAGGGGGTGCCCAGAGG + Intergenic
1077599227 11:3562009-3562031 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
1078050683 11:7962708-7962730 TTCTTCCTGTGGGTGCCTGGGGG - Intronic
1078268093 11:9769985-9770007 GGCTACCTGGAGGTGCACAGTGG - Intergenic
1081247020 11:40779838-40779860 GGCTACCTGTGGATGACCATTGG + Intronic
1081629338 11:44678064-44678086 GGCTTCTTCTGGGGGCCCTGTGG - Intergenic
1081863946 11:46349362-46349384 GGCTTCCTGTTGCTGCCCACAGG + Intronic
1083324129 11:61864994-61865016 GGCTCCTCGTGTGTGCCCAGTGG - Intronic
1083508324 11:63182222-63182244 GCCTTCCTCTGGGTGCTGAGGGG + Intronic
1083594181 11:63911162-63911184 TGCTTCCTGTCTGTGCCCTGTGG - Intergenic
1084012573 11:66360795-66360817 GGCTTGCTGTGGGTGACGGGTGG + Intronic
1084267442 11:68012279-68012301 TGCTCGCTGTGGGTGCCCACAGG - Intronic
1084529162 11:69717015-69717037 GGCTTGCAGAGGGTGGCCAGAGG + Intergenic
1084678362 11:70650107-70650129 GGCAACCTGAGGGTGCCAAGAGG + Intronic
1084709729 11:70836472-70836494 GACTTCCTGTGGGTGGCCCCGGG + Intronic
1084817621 11:71658672-71658694 AGCTTTCAGTGGGTGCTCAGTGG + Intergenic
1085296327 11:75433739-75433761 AGGTTACTGTGGGGGCCCAGTGG + Intergenic
1088291245 11:108240017-108240039 GGCATGCTGTGTGTGTCCAGTGG - Intronic
1089581932 11:119486866-119486888 GGCTCCCTGTGACTGTCCAGTGG + Intergenic
1089678222 11:120104814-120104836 GGATTCCTCTGTGAGCCCAGAGG + Intergenic
1092425369 12:8371357-8371379 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
1094317691 12:29150084-29150106 GGCATCCTGGGGGTGTGCAGGGG + Intronic
1095824637 12:46518373-46518395 GGCTTCCTTTGAGGGCCCAGTGG + Intergenic
1101518574 12:105460323-105460345 GGCTTTCTCTGGGGGCCCAGAGG - Intergenic
1103921030 12:124399254-124399276 GGCTTCCTCTGGGAGTCCTGTGG - Intronic
1104900315 12:132186513-132186535 GCCTTCCTGGGGGTGTCCGGTGG - Intergenic
1106464073 13:29997042-29997064 GGCATCCTGTAGGCTCCCAGTGG - Intergenic
1107120098 13:36786930-36786952 GGCTTCCTGTGGTTAAACAGAGG - Intergenic
1107438472 13:40403186-40403208 GGCTTCCTGTCTCTGACCAGAGG - Intergenic
1107781873 13:43912268-43912290 GGGTTCCTGTGGGTCGCCTGTGG + Intergenic
1109484593 13:63002031-63002053 GGCTTGCTGTGGCTGCCATGGGG - Intergenic
1112971383 13:105267076-105267098 GGGTTCAAATGGGTGCCCAGAGG - Intergenic
1113240259 13:108328954-108328976 GGCTTGCTGTGGCTGCTCTGGGG - Intergenic
1113365297 13:109670162-109670184 ACCTTCCTGTGGGTTCACAGAGG - Intergenic
1113475990 13:110581874-110581896 GGCTCCCTGTTACTGCCCAGTGG + Intergenic
1113642681 13:111969476-111969498 GGCTTTCTCTGGGAGCCCTGGGG - Intergenic
1113767322 13:112889483-112889505 TGCTTCCTGTGAGCGCCCTGCGG + Intergenic
1118043121 14:61938564-61938586 GGCTTCCTTTGGGGGCACAGTGG + Intergenic
1118109225 14:62697198-62697220 TGCTTCCTGTGGGTGCATATGGG - Intergenic
1118856790 14:69629337-69629359 GGCTTCCTGTGGGGGCCCAACGG - Intronic
1119642564 14:76326126-76326148 GAGTGCCTGTGGCTGCCCAGTGG + Intronic
1121007898 14:90501993-90502015 GGGGTCCTGCGGGTGGCCAGGGG - Intergenic
1122324694 14:100875229-100875251 GGGTACCTGAGGGTGCCCAATGG + Intergenic
1122810434 14:104285081-104285103 GGCTTCATGCGAGTGCCGAGGGG - Intergenic
1122987847 14:105220829-105220851 GGCTGCCTGTGAGTGCTGAGAGG - Intronic
1123112427 14:105879642-105879664 GGCAGCCTCAGGGTGCCCAGGGG - Intergenic
1124632043 15:31343523-31343545 GGCCACCTGTGGGTCCCCACTGG - Intronic
1133056436 16:3147742-3147764 GGATACCTGGGGGTGCTCAGGGG - Intronic
1133104760 16:3500261-3500283 GGATCACTGTGGGCGCCCAGAGG - Intergenic
1133372975 16:5259552-5259574 AGCTTTCAGTGGGTGCTCAGTGG + Intergenic
1134812950 16:17182773-17182795 GGCTATCTGGTGGTGCCCAGTGG - Intronic
1134842723 16:17414596-17414618 GGCTTCCTGTGGGTGCCCAGTGG - Intronic
1135328305 16:21541896-21541918 GACTTCCTCTGGGGGCCCTGAGG - Intergenic
1136338652 16:29627869-29627891 GACTTCCTTTGGGGGCCCTGAGG - Intergenic
1136542815 16:30937801-30937823 GGGGTCCTGTGGGTGCCCCCAGG + Intronic
1140040414 16:71403806-71403828 GGCTTGCTGTGGGCACCCAGAGG + Intergenic
1140901805 16:79374634-79374656 GGCTGCCTGTGGTCTCCCAGGGG + Intergenic
1141756877 16:85997139-85997161 GGCTTCATGTGGGAGACCCGTGG - Intergenic
1142137587 16:88458726-88458748 GTATTCCTGGAGGTGCCCAGTGG + Intronic
1142222028 16:88860219-88860241 GGCTTCCCAGGTGTGCCCAGTGG + Intronic
1143587425 17:7857273-7857295 GGCTTTGTGTGAGTGCCCCGCGG - Exonic
1143759089 17:9088207-9088229 GGACTTCTGTGGGTGCCCAGTGG + Intronic
1143963168 17:10737357-10737379 GGCTTCCTGGGAGAGCCAAGGGG - Intergenic
1144092643 17:11871822-11871844 GTCTTCCCATTGGTGCCCAGAGG - Intronic
1144251376 17:13420012-13420034 AGCTTCCTGTGTGAGCCCTGTGG - Intergenic
1146502340 17:33374762-33374784 AGGGTCCTGTGGGTGCCAAGTGG - Intronic
1146656423 17:34637633-34637655 GGCTTCCTGCAGGTGCCACGGGG + Exonic
1147534588 17:41311351-41311373 TGCTTCCTGTGAGTGCTGAGAGG + Intergenic
1147801036 17:43088089-43088111 GTATTCCTGTGTGTGCACAGGGG - Intronic
1147879963 17:43647092-43647114 AGGTTTCTGTGTGTGCCCAGAGG + Intronic
1150641634 17:66953463-66953485 GGCTTGCTCTGTGTGCCCAGGGG - Intergenic
1151209756 17:72535776-72535798 GGCTGCCTGGGGATGCCCTGGGG - Intergenic
1151712982 17:75817377-75817399 GGCTTCCTGATGGAGCCCGGTGG - Exonic
1152769404 17:82158006-82158028 CGCTTCCTGTCAGTGCCCAGGGG - Intronic
1152806438 17:82359083-82359105 GCCTTCCTGCAGGTGCCCAGGGG + Intergenic
1153915881 18:9743701-9743723 GTCTCCCTGTGGCTTCCCAGAGG - Intronic
1155164428 18:23221051-23221073 GGCTTCCTGAAGGTGCTCAGGGG - Intronic
1155394500 18:25372754-25372776 GGCTTCCGGTTGGTGGGCAGTGG - Intergenic
1156242420 18:35267119-35267141 GGCTTCCTCGGGGAGCCAAGAGG + Intronic
1159953470 18:74502850-74502872 AGCCTCCTGTGGGCTCCCAGTGG - Intronic
1160363665 18:78306390-78306412 GGCTTCCTTCCGGTGCCCTGGGG + Intergenic
1160895399 19:1399936-1399958 GGCGCCCTGTGTCTGCCCAGGGG - Exonic
1161288726 19:3481699-3481721 GGCTGCTTGTGGGTCCTCAGGGG - Intergenic
1161379295 19:3956144-3956166 GGCCTCCGGTGGGGTCCCAGAGG + Intergenic
1161470672 19:4455497-4455519 GGGTCCCTGTGGCTGCCCAGGGG - Intronic
1161684645 19:5696752-5696774 GTCCGCCTGTGGGTGCACAGCGG + Exonic
1162815181 19:13189812-13189834 GCCTTGCTGTGGGTCCACAGTGG - Intergenic
1163551484 19:17968167-17968189 GGCCTGTTGTGGGTCCCCAGCGG - Intronic
1164633523 19:29776839-29776861 GTCTTCCAGGGGGTGGCCAGGGG - Intergenic
1165300049 19:34963127-34963149 GGCTCCCTGTGGATGCACAGTGG - Intronic
1165956486 19:39504663-39504685 GGCTTCCTGGAGGTGGCCCGGGG + Intronic
1166695982 19:44851600-44851622 GGCTTCCTGTGGTGGCAGAGTGG - Intronic
1167278243 19:48551902-48551924 GGCTCCAGGTGGGTGCCCACAGG + Intergenic
1167391315 19:49196867-49196889 GGCTGCCGGTGAGTGCCCCGGGG + Exonic
1168629574 19:57946644-57946666 GGCTTCATCTGTGTGCACAGTGG - Intronic
925362441 2:3288923-3288945 GGGGGCCTGTGGCTGCCCAGGGG - Intronic
927250355 2:20990788-20990810 GGCTTCCTGCTGGCGCCCGGCGG - Intergenic
927364873 2:22283116-22283138 GGTTCCCTGTGTGTTCCCAGGGG + Intergenic
927449793 2:23198974-23198996 GACTTCCTGGGGCTGCCCAGGGG + Intergenic
927836030 2:26400075-26400097 GGCTGCCTGTGGGAGCAAAGAGG + Intergenic
932123127 2:69119333-69119355 GGCCTCCTGTGGCTGCTCTGTGG + Intronic
932445546 2:71778773-71778795 GGTTTCATGTGGGTGGTCAGAGG + Intergenic
932701589 2:73995994-73996016 GGCTCTCTGTGGGTCCCTAGTGG + Intronic
933094586 2:78162198-78162220 GGCATCTGGTGGGTGCCCCGTGG - Intergenic
933585017 2:84170490-84170512 TGCTTCCACTGGGTGCCCAGAGG + Intergenic
935255736 2:101308335-101308357 GGCGTCCCGTGGGCGCCCGGCGG - Exonic
935485971 2:103654665-103654687 GGTTTCCTGTGCGTGGGCAGAGG + Intergenic
936396310 2:112134491-112134513 GGGCTCCTCTGGGTCCCCAGTGG - Intergenic
937262713 2:120596610-120596632 CGCTGCCTGAGGGTGCCCCGAGG - Intergenic
937287695 2:120763531-120763553 GGCATCCAGTGGGTGCTCTGGGG + Intronic
937332117 2:121038198-121038220 GGCCTGCAGTGGGTGCACAGGGG + Intergenic
937982346 2:127623073-127623095 GCCATCCCGTGGGTTCCCAGGGG - Intronic
938384312 2:130853555-130853577 GGCCTCCTGTGTGTCCCCTGGGG + Intronic
938612143 2:132958932-132958954 TGCTTCCTGTGTCTGCCCACTGG + Intronic
939808585 2:146805071-146805093 GAGTTCCTGTGGGTGAGCAGAGG + Intergenic
941918324 2:170826664-170826686 TGCTTCCTGCAGCTGCCCAGAGG + Intronic
942534361 2:176948067-176948089 GGCTTGCTGTCGGTGCTGAGAGG - Intergenic
943479167 2:188396341-188396363 GGGCTCCTGTGAGGGCCCAGGGG + Intronic
943782237 2:191837333-191837355 GGCTTCCTGGGGGTGCACTCAGG + Intronic
1168897127 20:1331302-1331324 GGCTTCCTGGAGGAGCTCAGTGG - Intronic
1169550804 20:6699244-6699266 GTCTTCCTGATGGAGCCCAGTGG - Intergenic
1170117492 20:12876107-12876129 GGAGTCCTGGGGGTGCCCTGTGG - Intergenic
1170390269 20:15865752-15865774 GGCTTCCTGTTGGTCTCCTGTGG - Intronic
1172033084 20:31995334-31995356 GGCTCCCTGGGGATGCCCTGTGG + Intronic
1172225445 20:33302357-33302379 AGCTTCCTGAGAGTGCCCATCGG + Exonic
1172997696 20:39083329-39083351 GGGTCCCTGTGGGTGACCATGGG - Intergenic
1173733475 20:45344015-45344037 TGCTTCCTGGGGCTGGCCAGAGG - Intronic
1174202779 20:48818922-48818944 GGCTTCCTGGAGGAGGCCAGTGG - Intronic
1175413606 20:58787182-58787204 GCCTTCCTGGGGATGCCAAGGGG + Intergenic
1175496509 20:59418229-59418251 GGCATATAGTGGGTGCCCAGTGG - Intergenic
1175719525 20:61277454-61277476 GGCTTCATGTGAGTGCACTGAGG - Intronic
1175937377 20:62519979-62520001 AGCTGCCTGTGCGTGGCCAGTGG - Intergenic
1175990895 20:62788540-62788562 GGGTTCCTGTGGGTTCACAAGGG - Intergenic
1176000398 20:62828969-62828991 GGCTGCCGGTGAGTGCCCGGCGG + Exonic
1177578893 21:22994172-22994194 GGCTTGCTGTGGCTGCCTTGCGG - Intergenic
1178019600 21:28394106-28394128 GGCTTCCAGGGGGTGCCTGGAGG - Intergenic
1178350502 21:31869995-31870017 GGCGTTCTGTGGGAGCACAGAGG + Intergenic
1179512711 21:41884507-41884529 TGCTTCCTCTGTGTGGCCAGAGG - Intergenic
1179582543 21:42352464-42352486 GAGTCCCTGTGGTTGCCCAGTGG - Intergenic
1179826460 21:43968838-43968860 GGCTTCCGGGGGGTGGCCTGGGG - Intronic
1179828730 21:43982881-43982903 GGCTCCCAGTGGGGGCCCCGTGG + Exonic
1180151017 21:45947881-45947903 GGCTGCCTCTGGGTGTCCACTGG + Intergenic
1180819008 22:18812488-18812510 GGCTTGCTGTGGGTGCTCCAAGG - Intergenic
1180921904 22:19525404-19525426 GGCTTCCGGAGGGTGGCCTGGGG - Intronic
1181205232 22:21246936-21246958 GGCTTGCTGTGGGTGCTCCAAGG - Intergenic
1181596061 22:23915566-23915588 GGCTTCCTGTAATTCCCCAGGGG - Intergenic
1182558173 22:31140299-31140321 GGCTTCCTGGGGGTGGCCCTGGG - Exonic
1183393857 22:37560720-37560742 GCCTTCCTGTGGGCACCCGGGGG - Intronic
1183732499 22:39626506-39626528 GGCATCGTGTGGGTGGGCAGGGG + Intronic
1183748274 22:39704685-39704707 GGCTGCCTGTGGGTCCGGAGTGG + Intergenic
1183958792 22:41398413-41398435 GGCTTTCTGTGGGTTCCCGATGG + Exonic
1184456080 22:44610058-44610080 GGCTTGCTGGGGAAGCCCAGTGG + Intergenic
1184531959 22:45061892-45061914 GGAATCCTGTGGTGGCCCAGAGG + Intergenic
1184746189 22:46457656-46457678 GGCTTCCCGGGAATGCCCAGAGG + Intronic
1184749151 22:46474272-46474294 GGCTTCCTGGGGGTGTCAGGAGG - Intronic
1185074697 22:48676952-48676974 GGCTGCCCCTGGGAGCCCAGTGG - Intronic
1185143709 22:49117823-49117845 CATTCCCTGTGGGTGCCCAGAGG - Intergenic
1203221693 22_KI270731v1_random:48479-48501 GGCTTGCTGTGGGTGCTCCAAGG + Intergenic
1203269133 22_KI270734v1_random:38341-38363 GGCTTGCTGTGGGTGCTCCAAGG - Intergenic
950516991 3:13473474-13473496 GGCTTCCAGTGGATGCCGGGAGG + Intergenic
953387732 3:42516195-42516217 GGCTGGCTGTGTGTGCCCACAGG - Intronic
953471543 3:43170898-43170920 GGGTTCCTGTGTGTGTACAGGGG - Intergenic
954121617 3:48503430-48503452 GGCTTCCCATGGGTGGGCAGGGG + Intronic
954707842 3:52490493-52490515 GGCTTCCTGTGCAGCCCCAGGGG - Intronic
957070078 3:75560864-75560886 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
960054736 3:113269082-113269104 GCCTTCCTGTGTGTGCCTGGAGG - Intronic
960420911 3:117444358-117444380 TTCTTCCTGTTGGTGCCCAAAGG - Intergenic
960994470 3:123331911-123331933 GGCGTCCTGTGTGGGCCAAGGGG + Intronic
961284037 3:125785868-125785890 AGCTTTCAGTGGGTGCTCAGTGG + Intergenic
962983994 3:140517989-140518011 GGCTTGCTGTGGCTGCCTTGGGG + Intronic
963237751 3:142972388-142972410 GGCTTCCTGTGGCTGTGCACAGG + Intronic
965517827 3:169640973-169640995 GGCTTCAGGTGGGTGGCCAAAGG - Intronic
966871282 3:184291850-184291872 TGCCTGCTGTGGCTGCCCAGCGG - Intronic
969013666 4:4088326-4088348 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
969308900 4:6340711-6340733 GGATCCCTCTGGCTGCCCAGTGG - Intronic
969321709 4:6416826-6416848 GGCTCCCTGTGTGTGCCCCAGGG + Intronic
969515058 4:7642719-7642741 GGGGCTCTGTGGGTGCCCAGAGG + Intronic
970530879 4:16982130-16982152 TCCTTCCTTTGGGTGCCCAGAGG + Intergenic
972420019 4:38878281-38878303 GGCATCCTGAGGCTGCACAGGGG - Exonic
975377397 4:73661674-73661696 TGTTTCCTGTGGGTGTCCATTGG - Intergenic
976916088 4:90376187-90376209 GGCTGCCTGTGGTTACTCAGGGG + Intronic
982068139 4:151672674-151672696 CGCTCCCTGTGGCAGCCCAGAGG - Intronic
983267925 4:165527091-165527113 GGCTTCCTGTGTCTTCTCAGGGG + Intergenic
985530636 5:431839-431861 GGCCTCCTGGAGGTGCCCAGAGG + Intronic
985818317 5:2143057-2143079 GGCTGCCTGTAGGTCCCCAGGGG - Intergenic
985896490 5:2752194-2752216 GGCCTCCTCGGGGTGCACAGCGG - Exonic
985952770 5:3236182-3236204 GAATTCTTGTGGTTGCCCAGAGG - Intergenic
986154008 5:5155753-5155775 GACTTCCTGTTTGTCCCCAGTGG - Intronic
986265631 5:6187730-6187752 GCCTTCATGTGGGCTCCCAGGGG - Intergenic
986438337 5:7757296-7757318 GACTTCGTATGGGTCCCCAGGGG + Intronic
997191962 5:131945752-131945774 GCCTTCCTATAGGGGCCCAGTGG + Intronic
999280420 5:150361689-150361711 GGCTTCATCTGGGGGTCCAGGGG + Intronic
1000130271 5:158290547-158290569 GGCATCCTTTGTGTGTCCAGGGG + Intergenic
1001646009 5:173283041-173283063 GGCTTCCAGTGGGGCCCGAGAGG - Intergenic
1001809163 5:174613905-174613927 AGCTTCATATGAGTGCCCAGTGG - Intergenic
1003152721 6:3566183-3566205 TGCTTCCTGTTGGTGGACAGAGG + Intergenic
1003350446 6:5312836-5312858 GGCTTCCTGTTGGTGACTTGTGG + Intronic
1004760759 6:18663522-18663544 GGCTTCCTAATGGAGCCCAGTGG + Intergenic
1004884182 6:20036102-20036124 GGGTCCCTGTGGTTGCTCAGAGG + Intergenic
1005365398 6:25070773-25070795 GGCTTCCTTTGGGGTCCCAGTGG - Intergenic
1006152436 6:31996651-31996673 GGATCCCTGAGTGTGCCCAGAGG + Intronic
1006158742 6:32029388-32029410 GGATCCCTGAGTGTGCCCAGAGG + Intronic
1006380104 6:33692363-33692385 GGCGTCCTGAGGGTGGGCAGAGG + Intronic
1006452062 6:34110995-34111017 GGCAGCCTGAGGGTGCCCATGGG - Intronic
1006794158 6:36721574-36721596 GGCTTCCTGAGAGACCCCAGAGG - Exonic
1007104768 6:39276006-39276028 GCCTTTCTATGGGTGCCCAAGGG + Intergenic
1015732215 6:136360850-136360872 GTCTCCCAGGGGGTGCCCAGAGG + Intronic
1015944580 6:138486906-138486928 GACTTCCTGGGGCTACCCAGGGG + Intronic
1018060628 6:160086992-160087014 GGCTGCTTGTGGCTGCGCAGGGG - Intronic
1018784605 6:167098412-167098434 GGGGTCCTGTGGATGCCCGGAGG + Intergenic
1018860577 6:167708255-167708277 GGCTCACTGTGGGTGTCCAGCGG - Intergenic
1019103307 6:169649602-169649624 GGCTTTGTGTGGGAGCCCCGGGG - Intronic
1019348329 7:541360-541382 GGCTTCCTGTGGGTGGGGTGGGG - Intergenic
1019464524 7:1180077-1180099 GGCATCCTGAGGGCACCCAGGGG + Intergenic
1019712116 7:2522551-2522573 TGCTTCCTGTGGGTGTCCCCCGG + Intronic
1020697833 7:11437300-11437322 GGCTCCCTGAGGGAGCACAGAGG - Intronic
1021913926 7:25412840-25412862 GGCTTCCAGTGGGTGACTATTGG + Intergenic
1022028378 7:26469215-26469237 GGGTTCATGTGGGGGGCCAGTGG + Intergenic
1022307366 7:29159936-29159958 GGCATCCTTTGTGTGCCCATGGG + Intronic
1024193530 7:47036331-47036353 GGCTTCCTACGTGTGCCCATTGG + Intergenic
1025206394 7:56995749-56995771 GGCACCCTGTGCGTGCCCACTGG + Intergenic
1025665543 7:63581178-63581200 GGCACCCTGTGCGTGCCCACTGG - Intergenic
1026970786 7:74466216-74466238 GGCTACCTGTGGCTGCTTAGGGG + Intronic
1026977332 7:74506689-74506711 GGCAGCCTGTGGGTGCCCCCTGG + Intronic
1027133116 7:75605393-75605415 GGCTGCGTGTGGGAGGCCAGTGG + Intronic
1027191154 7:75996121-75996143 GGCTGCCTGGGGGTACCCAGAGG - Intergenic
1028792873 7:94873409-94873431 GGCTTGCTGTGGCTGCTCTGGGG + Intergenic
1028987087 7:97017334-97017356 GCATTCCTGTGGGTGCCAGGCGG - Intergenic
1029072318 7:97909953-97909975 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
1029697856 7:102226165-102226187 GGGTCGCCGTGGGTGCCCAGTGG - Intronic
1029750101 7:102538404-102538426 GGCTTCCTGAGGGGTTCCAGAGG - Intronic
1029768052 7:102637512-102637534 GGCTTCCTGAGGGGTTCCAGAGG - Exonic
1031075987 7:117213128-117213150 GGCTTCCTATGCATGGCCAGCGG - Intronic
1032202456 7:129831779-129831801 GGCTTCCAGAGGGAGCCCAAGGG + Exonic
1033589039 7:142795625-142795647 CGCTTCCTGCCGCTGCCCAGTGG + Intergenic
1033686429 7:143645065-143645087 GGCCTCCTGTGTGTTCACAGAGG - Intronic
1033689308 7:143722250-143722272 GGCCTCCTGTGTGTTCACAGAGG + Intronic
1033698183 7:143812556-143812578 GGCCTCCTGTGTGTTCACAGAGG + Intergenic
1034234495 7:149556012-149556034 GGCTGCCTCTGGGTGGCAAGAGG + Intergenic
1034340023 7:150346895-150346917 GGCTGGCAGTGTGTGCCCAGAGG + Intergenic
1034488447 7:151380679-151380701 GGCTCCCCTTGGGTGCCCGGTGG + Intronic
1034574769 7:151987569-151987591 GGCTCCCAGTGGGTCCCCTGTGG - Intronic
1035355342 7:158273277-158273299 GGCTTGCGGTGGGTGCTCACTGG - Intronic
1035953921 8:4054693-4054715 GAATTCCTGAGGGTGCCCAGAGG + Intronic
1036245345 8:7111348-7111370 AGCTTTCAGTGGGTGCTCAGTGG + Intergenic
1036255416 8:7202453-7202475 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
1036362074 8:8085050-8085072 AGCTTTCAGTGGGTGCTCAGTGG + Intergenic
1036888893 8:12581980-12582002 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
1036896475 8:12640122-12640144 AGCTTTCAGTGGGTGCTCAGTGG - Intergenic
1037316787 8:17606778-17606800 GGCTTACTATGTGTGCCAAGAGG - Intronic
1041708961 8:60875978-60876000 GGCTTTGTGTGAGGGCCCAGGGG - Intergenic
1044840042 8:96329567-96329589 TGTGGCCTGTGGGTGCCCAGAGG - Intronic
1045026443 8:98091538-98091560 GTCATACTGTGGGAGCCCAGGGG + Intronic
1046685512 8:117221695-117221717 GGCTTCCTGGGGGTGGGTAGGGG + Intergenic
1047903643 8:129449918-129449940 GCCTGCCTGTGGGGGCCTAGTGG - Intergenic
1048333806 8:133488914-133488936 GGCTTCCTGTGGCTCCCAGGAGG - Intronic
1048906458 8:139093853-139093875 GGCCACCTGTGGGTGTGCAGGGG + Intergenic
1049403851 8:142442963-142442985 TGTTTCCTGTGGGGGCCCCGGGG - Intergenic
1049532643 8:143162141-143162163 GGCTCTGTGTGGGTGCCAAGTGG - Intergenic
1049575688 8:143388711-143388733 GGATGCCAGTGGGTTCCCAGGGG + Intergenic
1049975691 9:859424-859446 GGGTGCCTGTGGGTCCCCTGGGG + Intronic
1050719586 9:8571036-8571058 GGCTTCCACTGAGTGCCCACAGG + Intronic
1053477476 9:38392825-38392847 GGCTTCCCGAGGGAGCCGAGGGG - Intronic
1053825083 9:42014161-42014183 TGCTTCCTGGGGGTGTCAAGAGG + Intronic
1054605487 9:67173202-67173224 TGCTTCCTGGGGGTGTCAAGAGG - Intergenic
1054810609 9:69431033-69431055 GGCTTTCTGGGTGTGTCCAGGGG - Exonic
1056586548 9:87931168-87931190 GTGGTCCTGTGGGTGTCCAGAGG + Intergenic
1056919116 9:90770597-90770619 TTGTTCCTGTGGGTGCCAAGGGG + Intergenic
1057077190 9:92144173-92144195 TGCCTCCTGTGGGTGCTCCGTGG + Intergenic
1057142271 9:92734788-92734810 GCCCTCCTGTGGGTGGGCAGGGG - Intronic
1057162022 9:92895542-92895564 GTGGTCCTGTGGGTGTCCAGAGG + Intergenic
1057210872 9:93200367-93200389 GGCTGTCTGTGTCTGCCCAGAGG + Intronic
1060407876 9:123381742-123381764 GGGCTCGTGTGGGTGCCCATGGG + Exonic
1060556048 9:124507642-124507664 GGCCCGCTGTGGGAGCCCAGAGG + Intergenic
1060932678 9:127498630-127498652 GGCTTCCTGCTTGTGCCCATTGG + Intronic
1061220356 9:129246950-129246972 GGCTTCGTATGGGTCTCCAGGGG + Intergenic
1061520456 9:131114511-131114533 GTCTCCCTGTGGGGACCCAGTGG - Intronic
1062034342 9:134376191-134376213 GCCTTCTTGTGGAGGCCCAGAGG + Intronic
1062433257 9:136535265-136535287 GGCTTCGGGTGGGTCCCCAAGGG - Intronic
1062530211 9:136996382-136996404 CCCTTCCTGTGGGTGGCTAGGGG - Intronic
1186510973 X:10129571-10129593 GGCTTCCTGCTGCTTCCCAGTGG + Intronic
1190436263 X:50428870-50428892 GGCTTCCTGGGGCTGCCTATTGG - Intronic
1191106028 X:56772859-56772881 GTCCTCCTGTGGTTTCCCAGAGG + Intergenic
1191107021 X:56778261-56778283 GTCCTCCTGTGGTTTCCCAGAGG + Intergenic
1191108572 X:56788000-56788022 GTCCTCCTGTGGTTTCCCAGAGG + Intergenic
1191109397 X:56793263-56793285 GTCCTCCTGTGGTTTCCCAGAGG + Intergenic
1191110917 X:56802704-56802726 GTCTTCCTGTGGTTTCCCAGTGG + Intergenic
1191145828 X:57164274-57164296 TCCTTCCTGTAGGTGCCCAATGG + Intergenic
1192224427 X:69218455-69218477 GGCTTTCAGTGGGGCCCCAGAGG + Intergenic
1195687675 X:107601138-107601160 GGCTGCCTGTGGGTGCTCTGGGG - Exonic
1196479956 X:116136220-116136242 GGCCTCATGTGTCTGCCCAGTGG + Intergenic
1198664737 X:139008126-139008148 GGCTTCCTGTGGCTGCCTTTGGG - Intronic
1199591389 X:149471145-149471167 GGCGCCCTGTGGCTGCCCAGGGG + Intergenic