ID: 1134842724

View in Genome Browser
Species Human (GRCh38)
Location 16:17414606-17414628
Sequence TGTGTGTCAGGGCTTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134842724_1134842730 13 Left 1134842724 16:17414606-17414628 CCCACAGGAAGCCCTGACACACA No data
Right 1134842730 16:17414642-17414664 GCAAAAGGGCATTTCTGCAAAGG 0: 1
1: 0
2: 0
3: 25
4: 195
1134842724_1134842729 -1 Left 1134842724 16:17414606-17414628 CCCACAGGAAGCCCTGACACACA No data
Right 1134842729 16:17414628-17414650 ATAATGAGAAATGAGCAAAAGGG 0: 1
1: 0
2: 8
3: 105
4: 975
1134842724_1134842731 14 Left 1134842724 16:17414606-17414628 CCCACAGGAAGCCCTGACACACA No data
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data
1134842724_1134842728 -2 Left 1134842724 16:17414606-17414628 CCCACAGGAAGCCCTGACACACA No data
Right 1134842728 16:17414627-17414649 CATAATGAGAAATGAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134842724 Original CRISPR TGTGTGTCAGGGCTTCCTGT GGG (reversed) Intronic
No off target data available for this crispr