ID: 1134842726

View in Genome Browser
Species Human (GRCh38)
Location 16:17414617-17414639
Sequence ATTTCTCATTATGTGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134842726_1134842731 3 Left 1134842726 16:17414617-17414639 CCCTGACACACATAATGAGAAAT No data
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data
1134842726_1134842730 2 Left 1134842726 16:17414617-17414639 CCCTGACACACATAATGAGAAAT No data
Right 1134842730 16:17414642-17414664 GCAAAAGGGCATTTCTGCAAAGG 0: 1
1: 0
2: 0
3: 25
4: 195
1134842726_1134842732 26 Left 1134842726 16:17414617-17414639 CCCTGACACACATAATGAGAAAT No data
Right 1134842732 16:17414666-17414688 AGATGAAAAACAAATCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134842726 Original CRISPR ATTTCTCATTATGTGTGTCA GGG (reversed) Intronic
No off target data available for this crispr