ID: 1134842727

View in Genome Browser
Species Human (GRCh38)
Location 16:17414618-17414640
Sequence CATTTCTCATTATGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134842727_1134842730 1 Left 1134842727 16:17414618-17414640 CCTGACACACATAATGAGAAATG No data
Right 1134842730 16:17414642-17414664 GCAAAAGGGCATTTCTGCAAAGG 0: 1
1: 0
2: 0
3: 25
4: 195
1134842727_1134842733 30 Left 1134842727 16:17414618-17414640 CCTGACACACATAATGAGAAATG No data
Right 1134842733 16:17414671-17414693 AAAAACAAATCTTAGAGGAGTGG No data
1134842727_1134842732 25 Left 1134842727 16:17414618-17414640 CCTGACACACATAATGAGAAATG No data
Right 1134842732 16:17414666-17414688 AGATGAAAAACAAATCTTAGAGG No data
1134842727_1134842731 2 Left 1134842727 16:17414618-17414640 CCTGACACACATAATGAGAAATG No data
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134842727 Original CRISPR CATTTCTCATTATGTGTGTC AGG (reversed) Intronic
No off target data available for this crispr