ID: 1134842731

View in Genome Browser
Species Human (GRCh38)
Location 16:17414643-17414665
Sequence CAAAAGGGCATTTCTGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134842725_1134842731 13 Left 1134842725 16:17414607-17414629 CCACAGGAAGCCCTGACACACAT No data
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data
1134842724_1134842731 14 Left 1134842724 16:17414606-17414628 CCCACAGGAAGCCCTGACACACA No data
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data
1134842727_1134842731 2 Left 1134842727 16:17414618-17414640 CCTGACACACATAATGAGAAATG No data
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data
1134842726_1134842731 3 Left 1134842726 16:17414617-17414639 CCCTGACACACATAATGAGAAAT No data
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data
1134842723_1134842731 24 Left 1134842723 16:17414596-17414618 CCACTGGGCACCCACAGGAAGCC 0: 1
1: 0
2: 1
3: 32
4: 305
Right 1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134842731 Original CRISPR CAAAAGGGCATTTCTGCAAA GGG Intronic
No off target data available for this crispr